Rh6BG123100

Organ-specific protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
19193655 .. 19195211
1557 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG123100.1

Sequence Viewer

Length: 717 bp
ATGATTCTCGTGGCTAGCTTAACTTTATTATATGAAGGCTTTTATTCTCCTACTAGTTTATCTATAAATATTCTGAATTTACGTATCATTGCAACATCGAAAAAAGGCTTCTTTCATAGCATTGCCATCATGAACTCCCTTTGTGCCATCTTAGCTCTGCTCTCACTTCTTTTGTTCACTACAACTGTAGAATCAAGAATAGGTGCAGGAGGCTACATGAAAAATTCCATTAAAAAGCAACCCACGCCAGGAGACTTACGGAAGCTCGTAAAAGAACAGTTTGAGCTTCACAATGCTGATCTATCTGATGATAAGACTGAGAAAGCCAACTGCAATGAAAATGGGAAACCTAACACTGAATTTGAGATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACTTTGAACCGAGGCCTGATGTCACAATTTACCATGGTGACTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACAGTGAAGTAACAGAGTCCAGAACTCTTAAAGACGAGCTAGAGTCTAAGGCCATAGGTAACATGCACCCTAAGGATAAAGGTCCTAAAGATAAGCTGCCATTTGAAGTCAAAGCCAAAAGGCATGCATTTGAAGAAGATTTTGAGCCAAGGCCAAATATTTCTGTGTACAATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

238

Amino Acids

26.96

Weight (kDa)

5.24

Isoelectric Point (pI)

38.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Organ_specific PF10950 69 - 165 1.4e-07 Organ specific protein
Organ_specific PF10950 166 - 237 1.5e-07 Organ specific protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 76, 223, 359
AfaI GTAC 1 cut(s) 707
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 6 cut(s) 380, 428, 467, 506, 644, 671
AhdI GACNNNNNGTC 3 cut(s) 392, 440, 518
AhlI ACTAGT 1 cut(s) 53
AjnI CCWGG 1 cut(s) 247
AluBI AGCT 6 cut(s) 18, 155, 265, 286, 577, 634
AluI AGCT 6 cut(s) 18, 155, 265, 286, 577, 634
Alw26I GTCTC 4 cut(s) 246, 379, 427, 505
AoxI GGCC 3 cut(s) 473, 588, 689
ApeKI GCWGC 1 cut(s) 634
ApoI RAATTY 3 cut(s) 76, 223, 359
AspS9I GGNCC 1 cut(s) 620
AsuHPI GGTGA 4 cut(s) 422, 470, 509, 548
AsuNHI GCTAGC 1 cut(s) 14
AvaII GGWCC 1 cut(s) 620
AxyI CCTNAGG 1 cut(s) 609
BauI CACGAG 1 cut(s) 8
BbvI GCAGC 1 cut(s) 621
BccI CCATC 2 cut(s) 134, 155
BciT130I CCWGG 1 cut(s) 249
BcoDI GTCTC 4 cut(s) 246, 379, 427, 505
BcuI ACTAGT 1 cut(s) 53
BfaI CTAG 3 cut(s) 15, 54, 578
BfmI CTRYAG 1 cut(s) 186
BisI GCNGC 1 cut(s) 635
BlsI GCNGC 1 cut(s) 636
Bme1390I CCNGG 1 cut(s) 249
Bme18I GGWCC 1 cut(s) 620
BmeRI GACNNNNNGTC 3 cut(s) 392, 440, 518
BmgT120I GGNCC 1 cut(s) 620
BmrFI CCNGG 1 cut(s) 249
BmtI GCTAGC 1 cut(s) 18
BsaAI YACGTR 1 cut(s) 83
BsaI GGTCTC 3 cut(s) 379, 427, 505
BsaJI CCNNGG 6 cut(s) 406, 454, 470, 493, 532, 686
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse21I CCTNAGG 1 cut(s) 609
Bse3DI GCAATG 3 cut(s) 87, 120, 340
BseBI CCWGG 1 cut(s) 249
BseDI CCNNGG 6 cut(s) 406, 454, 470, 493, 532, 686
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMI GCAATG 3 cut(s) 87, 120, 340
BseMII CTCAG 1 cut(s) 309
BseXI GCAGC 1 cut(s) 621
BsgI GTGCAG 1 cut(s) 225
BshFI GGCC 3 cut(s) 475, 590, 691
BslI CCNNNNNNNGG 1 cut(s) 248
BsmAI GTCTC 4 cut(s) 246, 379, 427, 505
BsnI GGCC 3 cut(s) 475, 590, 691
Bso31I GGTCTC 3 cut(s) 379, 427, 505
Bsp1407I TGTACA 1 cut(s) 705
Bsp143I GATC 1 cut(s) 298
Bsp19I CCATGG 4 cut(s) 406, 454, 493, 532
BspANI GGCC 3 cut(s) 475, 590, 691
BspCNI CTCAG 1 cut(s) 310
BspHI TCATGA 1 cut(s) 129
BspOI GCTAGC 1 cut(s) 18
BspTNI GGTCTC 3 cut(s) 379, 427, 505
BsrDI GCAATG 3 cut(s) 87, 120, 340
BsrGI TGTACA 1 cut(s) 705
BssECI CCNNGG 6 cut(s) 406, 454, 470, 493, 532, 686
BssMI GATC 1 cut(s) 298
BssSI CACGAG 1 cut(s) 8
BssT1I CCWWGG 5 cut(s) 406, 454, 493, 532, 686
Bst2BI CACGAG 1 cut(s) 8
Bst2UI CCWGG 1 cut(s) 249
Bst4CI ACNGT 3 cut(s) 187, 279, 542
BstAUI TGTACA 1 cut(s) 705
BstBAI YACGTR 1 cut(s) 83
BstC8I GCNNGC 2 cut(s) 16, 663
BstDEI CTNAG 4 cut(s) 151, 318, 585, 609
BstDSI CCRYGG 4 cut(s) 406, 454, 493, 532
BstKTI GATC 1 cut(s) 301
BstMAI GTCTC 4 cut(s) 246, 379, 427, 505
BstMBI GATC 1 cut(s) 298
BstMWI GCNNNNNNNGC 2 cut(s) 152, 244
BstNI CCWGG 1 cut(s) 249
BstNSI RCATGY 2 cut(s) 604, 665
BstSCI CCNGG 1 cut(s) 247
BstSFI CTRYAG 1 cut(s) 186
BstSNI TACGTA 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 621
Bsu36I CCTNAGG 1 cut(s) 609
BsuRI GGCC 3 cut(s) 475, 590, 691
BtgI CCRYGG 4 cut(s) 406, 454, 493, 532
BtsIMutI CAGTG 2 cut(s) 354, 547
Cac8I GCNNGC 2 cut(s) 16, 663
CciI TCATGA 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 620
Csp6I GTAC 1 cut(s) 706
CviAII CATG 8 cut(s) 130, 217, 407, 455, 494, 533, 601, 662
CviQI GTAC 1 cut(s) 706
DdeI CTNAG 4 cut(s) 151, 318, 585, 609
DpnI GATC 1 cut(s) 300
DpnII GATC 1 cut(s) 298
DriI GACNNNNNGTC 3 cut(s) 392, 440, 518
Eam1105I GACNNNNNGTC 3 cut(s) 392, 440, 518
Eco105I TACGTA 1 cut(s) 83
Eco130I CCWWGG 5 cut(s) 406, 454, 493, 532, 686
Eco147I AGGCCT 1 cut(s) 475
Eco31I GGTCTC 3 cut(s) 379, 427, 505
Eco47I GGWCC 1 cut(s) 620
Eco81I CCTNAGG 1 cut(s) 609
EcoO109I RGGNCCY 1 cut(s) 620
EcoRII CCWGG 1 cut(s) 247
EcoT14I CCWWGG 5 cut(s) 406, 454, 493, 532, 686
EcoT22I ATGCAT 1 cut(s) 667
ErhI CCWWGG 5 cut(s) 406, 454, 493, 532, 686
FaeI CATG 8 cut(s) 133, 220, 410, 458, 497, 536, 604, 665
FatI CATG 8 cut(s) 129, 216, 406, 454, 493, 532, 600, 661
Fnu4HI GCNGC 1 cut(s) 635
Fsp4HI GCNGC 1 cut(s) 635
FspBI CTAG 3 cut(s) 15, 54, 578
GluI GCNGC 1 cut(s) 635
HaeIII GGCC 3 cut(s) 475, 590, 691
Hin1II CATG 8 cut(s) 133, 220, 410, 458, 497, 536, 604, 665
HinfI GANTC 4 cut(s) 4, 191, 554, 581
HphI GGTGA 4 cut(s) 422, 470, 509, 548
Hpy166II GTNNAC 2 cut(s) 177, 706
Hpy188I TCNGA 2 cut(s) 75, 307
Hpy188III TCNNGA 3 cut(s) 130, 195, 558
Hpy8I GTNNAC 2 cut(s) 177, 706
HpyAV CCTTC 1 cut(s) 29
HpyCH4III ACNGT 3 cut(s) 187, 279, 542
HpyCH4IV ACGT 1 cut(s) 82
HpyCH4V TGCA 5 cut(s) 92, 206, 333, 604, 665
HpyF10VI GCNNNNNNNGC 2 cut(s) 152, 244
HpyF3I CTNAG 4 cut(s) 151, 318, 585, 609
HpySE526I ACGT 1 cut(s) 82
Hsp92II CATG 8 cut(s) 133, 220, 410, 458, 497, 536, 604, 665
Kzo9I GATC 1 cut(s) 298
LpnPI CCDG 8 cut(s) 192, 234, 261, 402, 450, 489, 528, 571
Lsp1109I GCAGC 1 cut(s) 621
MaeI CTAG 3 cut(s) 15, 54, 578
MaeII ACGT 1 cut(s) 82
MalI GATC 1 cut(s) 300
MboI GATC 1 cut(s) 298
MboII GAAGA 2 cut(s) 683, 686
MluCI AATT 7 cut(s) 76, 223, 359, 399, 447, 486, 525
MlyI GAGTC 2 cut(s) 563, 590
MnlI CCTC 2 cut(s) 203, 465
Mph1103I ATGCAT 1 cut(s) 667
MseI TTAA 3 cut(s) 20, 231, 567
MspR9I CCNGG 1 cut(s) 249
MvaI CCWGG 1 cut(s) 249
MwoI GCNNNNNNNGC 2 cut(s) 152, 244
NcoI CCATGG 4 cut(s) 406, 454, 493, 532
NdeII GATC 1 cut(s) 298
NheI GCTAGC 1 cut(s) 14
NlaIII CATG 8 cut(s) 133, 220, 410, 458, 497, 536, 604, 665
NmuCI GTSAC 8 cut(s) 394, 410, 442, 458, 481, 497, 520, 536
NsiI ATGCAT 1 cut(s) 667
NspI RCATGY 2 cut(s) 604, 665
PaeI GCATGC 1 cut(s) 665
PagI TCATGA 1 cut(s) 129
PceI AGGCCT 1 cut(s) 475
PfeI GAWTC 2 cut(s) 4, 191
PflFI GACNNNGTC 1 cut(s) 416
PkrI GCNGC 1 cut(s) 636
PleI GAGTC 2 cut(s) 562, 589
PpsI GAGTC 2 cut(s) 562, 589
Ppu21I YACGTR 1 cut(s) 83
PpuMI RGGWCCY 1 cut(s) 620
Psp5II RGGWCCY 1 cut(s) 620
Psp6I CCWGG 1 cut(s) 247
PspGI CCWGG 1 cut(s) 247
PspPI GGNCC 1 cut(s) 620
PspPPI RGGWCCY 1 cut(s) 620
PsyI GACNNNGTC 1 cut(s) 416
RsaI GTAC 1 cut(s) 707
RsaNI GTAC 1 cut(s) 706
SaqAI TTAA 3 cut(s) 20, 231, 567
SatI GCNGC 1 cut(s) 635
Sau3AI GATC 1 cut(s) 298
Sau96I GGNCC 1 cut(s) 620
SchI GAGTC 2 cut(s) 563, 590
ScrFI CCNGG 1 cut(s) 249
SfcI CTRYAG 1 cut(s) 186
SinI GGWCC 1 cut(s) 620
SnaBI TACGTA 1 cut(s) 83
SpeI ACTAGT 1 cut(s) 53
SphI GCATGC 1 cut(s) 665
Sse9I AATT 7 cut(s) 76, 223, 359, 399, 447, 486, 525
SseBI AGGCCT 1 cut(s) 475
SspI AATATT 2 cut(s) 70, 697
SspMI CTAG 3 cut(s) 15, 54, 578
StuI AGGCCT 1 cut(s) 475
StyD4I CCNGG 1 cut(s) 247
StyI CCWWGG 5 cut(s) 406, 454, 493, 532, 686
TaaI ACNGT 3 cut(s) 187, 279, 542
TaiI ACGT 1 cut(s) 85
TaqI TCGA 3 cut(s) 98, 372, 420
TasI AATT 7 cut(s) 76, 223, 359, 399, 447, 486, 525
TatI WGTACW 1 cut(s) 705
TfiI GAWTC 2 cut(s) 4, 191
Tru1I TTAA 3 cut(s) 20, 231, 567
Tru9I TTAA 3 cut(s) 20, 231, 567
TscAI CASTG 2 cut(s) 361, 547
TseFI GTSAC 8 cut(s) 394, 410, 442, 458, 481, 497, 520, 536
TseI GCWGC 1 cut(s) 634
Tsp45I GTSAC 8 cut(s) 394, 410, 442, 458, 481, 497, 520, 536
TspDTI ATGAA 5 cut(s) 48, 104, 146, 233, 351
TspGWI ACGGA 1 cut(s) 274
TspRI CASTG 2 cut(s) 361, 547
Tth111I GACNNNGTC 1 cut(s) 416
VpaK11BI GGWCC 1 cut(s) 620
XapI RAATTY 3 cut(s) 76, 223, 359
XceI RCATGY 2 cut(s) 604, 665
XspI CTAG 3 cut(s) 15, 54, 578
Zsp2I ATGCAT 1 cut(s) 667
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.