Rroxscaffold_176G00431290

Organ-specific protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000176
OG0001115
Physical Location & Seq
Forward (+)
867830 .. 868234
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_176G00431290.1

Sequence Viewer

Length: 405 bp
ATGAAAAATTCCATTAAAAAGCAACCGACGCCAGGAGACTTACGGAAGCTCGTAAAAGAACAGTTTGAGCTTAACAATGCTGATCTATCTGATGATAAGACTGGGAAAGCCAACTGCAATGAAAATGGGAAACCTAACACTGAATTTGAGATTGTCGAGTTTGAACCAAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTATCATGGTGACAGTGAAGTAACAGAGTCCAGAACTCTTAAAGACGAGCTAGAGTCTAAGGCCATAGTTAACATGCACCCTAAGGATAATGGTCCTAAAGATAAGCTGCCACTTGAAGTCAAAGCCAAAAGGCATGCATTTGAAGTAGATCGGCCAAATGTTTCTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Organ_specific

Protein Analysis

134

Amino Acids

15.24

Weight (kDa)

5.27

Isoelectric Point (pI)

25.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 386
AcsI RAATTY 2 cut(s) 7, 143
AcyI GRCGYC 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 4 cut(s) 164, 212, 350, 377
AhdI GACNNNNNGTC 2 cut(s) 176, 224
AjnI CCWGG 1 cut(s) 31
AluBI AGCT 4 cut(s) 49, 70, 283, 340
AluI AGCT 4 cut(s) 49, 70, 283, 340
Alw26I GTCTC 2 cut(s) 30, 211
AoxI GGCC 2 cut(s) 294, 386
ApeKI GCWGC 1 cut(s) 340
ApoI RAATTY 2 cut(s) 7, 143
AspS9I GGNCC 1 cut(s) 326
AsuHPI GGTGA 2 cut(s) 206, 254
AvaII GGWCC 1 cut(s) 326
AxyI CCTNAGG 1 cut(s) 315
BbvI GCAGC 1 cut(s) 327
BciT130I CCWGG 1 cut(s) 33
BcoDI GTCTC 2 cut(s) 30, 211
BfaI CTAG 1 cut(s) 284
BisI GCNGC 1 cut(s) 341
BlsI GCNGC 1 cut(s) 342
Bme1390I CCNGG 1 cut(s) 33
Bme18I GGWCC 1 cut(s) 326
BmeRI GACNNNNNGTC 2 cut(s) 176, 224
BmgT120I GGNCC 1 cut(s) 326
BmrFI CCNGG 1 cut(s) 33
BmrI ACTGGG 1 cut(s) 111
BmuI ACTGGG 1 cut(s) 111
BsaHI GRCGYC 1 cut(s) 29
BsaI GGTCTC 1 cut(s) 211
BsaJI CCNNGG 1 cut(s) 190
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 106
Bse21I CCTNAGG 1 cut(s) 315
Bse3DI GCAATG 1 cut(s) 124
BseBI CCWGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 190
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMI GCAATG 1 cut(s) 124
BseNI ACTGG 1 cut(s) 106
BseXI GCAGC 1 cut(s) 327
BshFI GGCC 2 cut(s) 296, 388
BslI CCNNNNNNNGG 1 cut(s) 32
BsmAI GTCTC 2 cut(s) 30, 211
BsnI GGCC 2 cut(s) 296, 388
Bso31I GGTCTC 1 cut(s) 211
Bsp143I GATC 2 cut(s) 82, 382
Bsp19I CCATGG 1 cut(s) 190
BspANI GGCC 2 cut(s) 296, 388
BspTNI GGTCTC 1 cut(s) 211
BsrDI GCAATG 1 cut(s) 124
BsrI ACTGG 1 cut(s) 106
BssECI CCNNGG 1 cut(s) 190
BssMI GATC 2 cut(s) 82, 382
BssNI GRCGYC 1 cut(s) 29
BssT1I CCWWGG 1 cut(s) 190
Bst2UI CCWGG 1 cut(s) 33
Bst4CI ACNGT 2 cut(s) 63, 248
BstACI GRCGYC 1 cut(s) 29
BstC8I GCNNGC 1 cut(s) 369
BstDEI CTNAG 2 cut(s) 291, 315
BstDSI CCRYGG 1 cut(s) 190
BstKTI GATC 2 cut(s) 85, 385
BstMAI GTCTC 2 cut(s) 30, 211
BstMBI GATC 2 cut(s) 82, 382
BstMWI GCNNNNNNNGC 1 cut(s) 28
BstNI CCWGG 1 cut(s) 33
BstNSI RCATGY 2 cut(s) 310, 371
BstSCI CCNGG 1 cut(s) 31
BstV1I GCAGC 1 cut(s) 327
Bsu36I CCTNAGG 1 cut(s) 315
BsuRI GGCC 2 cut(s) 296, 388
BtgI CCRYGG 1 cut(s) 190
BtsIMutI CAGTG 2 cut(s) 138, 253
Cac8I GCNNGC 1 cut(s) 369
Cfr13I GGNCC 1 cut(s) 326
CseI GACGC 1 cut(s) 37
CviAII CATG 4 cut(s) 191, 239, 307, 368
CviJI RGCY 8 cut(s) 49, 70, 110, 283, 296, 340, 359, 388
CviKI_1 RGCY 8 cut(s) 49, 70, 110, 283, 296, 340, 359, 388
DdeI CTNAG 2 cut(s) 291, 315
DpnI GATC 2 cut(s) 84, 384
DpnII GATC 2 cut(s) 82, 382
DriI GACNNNNNGTC 2 cut(s) 176, 224
EaeI YGGCCR 1 cut(s) 386
Eam1105I GACNNNNNGTC 2 cut(s) 176, 224
Eco130I CCWWGG 1 cut(s) 190
Eco31I GGTCTC 1 cut(s) 211
Eco47I GGWCC 1 cut(s) 326
Eco81I CCTNAGG 1 cut(s) 315
EcoRII CCWGG 1 cut(s) 31
EcoT14I CCWWGG 1 cut(s) 190
EcoT22I ATGCAT 1 cut(s) 373
ErhI CCWWGG 1 cut(s) 190
FaeI CATG 4 cut(s) 194, 242, 310, 371
FaiI YATR 5 cut(s) 192, 240, 299, 308, 369
FatI CATG 4 cut(s) 190, 238, 306, 367
Fnu4HI GCNGC 1 cut(s) 341
Fsp4HI GCNGC 1 cut(s) 341
FspBI CTAG 1 cut(s) 284
GluI GCNGC 1 cut(s) 341
HaeIII GGCC 2 cut(s) 296, 388
HgaI GACGC 1 cut(s) 37
Hin1I GRCGYC 1 cut(s) 29
Hin1II CATG 4 cut(s) 194, 242, 310, 371
HincII GTYRAC 1 cut(s) 304
HindII GTYRAC 1 cut(s) 304
HinfI GANTC 2 cut(s) 260, 287
HpaI GTTAAC 1 cut(s) 304
HphI GGTGA 2 cut(s) 206, 254
Hpy166II GTNNAC 1 cut(s) 304
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 1 cut(s) 264
Hpy8I GTNNAC 1 cut(s) 304
Hpy99I CGWCG 1 cut(s) 31
HpyCH4III ACNGT 2 cut(s) 63, 248
HpyCH4V TGCA 3 cut(s) 117, 310, 371
HpyF10VI GCNNNNNNNGC 1 cut(s) 28
HpyF3I CTNAG 2 cut(s) 291, 315
Hsp92I GRCGYC 1 cut(s) 29
Hsp92II CATG 4 cut(s) 194, 242, 310, 371
KspAI GTTAAC 1 cut(s) 304
Kzo9I GATC 2 cut(s) 82, 382
LpnPI CCDG 6 cut(s) 18, 45, 87, 186, 234, 277
Lsp1109I GCAGC 1 cut(s) 327
MaeI CTAG 1 cut(s) 284
MaeIII GTNAC 5 cut(s) 178, 194, 226, 242, 253
MalI GATC 2 cut(s) 84, 384
MboI GATC 2 cut(s) 82, 382
MluCI AATT 4 cut(s) 7, 143, 183, 231
MlyI GAGTC 2 cut(s) 269, 296
Mph1103I ATGCAT 1 cut(s) 373
MseI TTAA 4 cut(s) 15, 72, 273, 303
MspR9I CCNGG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 28
NcoI CCATGG 1 cut(s) 190
NdeII GATC 2 cut(s) 82, 382
NlaIII CATG 4 cut(s) 194, 242, 310, 371
NmuCI GTSAC 4 cut(s) 178, 194, 226, 242
NsiI ATGCAT 1 cut(s) 373
NspI RCATGY 2 cut(s) 310, 371
PaeI GCATGC 1 cut(s) 371
PflFI GACNNNGTC 1 cut(s) 200
PkrI GCNGC 1 cut(s) 342
PleI GAGTC 2 cut(s) 268, 295
PpsI GAGTC 2 cut(s) 268, 295
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
PspPI GGNCC 1 cut(s) 326
PsyI GACNNNGTC 1 cut(s) 200
SaqAI TTAA 4 cut(s) 15, 72, 273, 303
SatI GCNGC 1 cut(s) 341
Sau3AI GATC 2 cut(s) 82, 382
Sau96I GGNCC 1 cut(s) 326
SchI GAGTC 2 cut(s) 269, 296
ScrFI CCNGG 1 cut(s) 33
SetI ASST 7 cut(s) 51, 72, 136, 175, 223, 285, 342
SinI GGWCC 1 cut(s) 326
SphI GCATGC 1 cut(s) 371
Sse9I AATT 4 cut(s) 7, 143, 183, 231
SspMI CTAG 1 cut(s) 284
StyD4I CCNGG 1 cut(s) 31
StyI CCWWGG 1 cut(s) 190
TaaI ACNGT 2 cut(s) 63, 248
TaqI TCGA 2 cut(s) 156, 204
TasI AATT 4 cut(s) 7, 143, 183, 231
Tru1I TTAA 4 cut(s) 15, 72, 273, 303
Tru9I TTAA 4 cut(s) 15, 72, 273, 303
TscAI CASTG 2 cut(s) 145, 253
TseFI GTSAC 4 cut(s) 178, 194, 226, 242
TseI GCWGC 1 cut(s) 340
Tsp45I GTSAC 4 cut(s) 178, 194, 226, 242
TspDTI ATGAA 2 cut(s) 17, 135
TspGWI ACGGA 1 cut(s) 58
TspRI CASTG 2 cut(s) 145, 253
Tth111I GACNNNGTC 1 cut(s) 200
VpaK11BI GGWCC 1 cut(s) 326
XapI RAATTY 2 cut(s) 7, 143
XceI RCATGY 2 cut(s) 310, 371
XspI CTAG 1 cut(s) 284
Zsp2I ATGCAT 1 cut(s) 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.