Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00002303

Orthogroup ID

OG0002208

Physical Location & Seq

Genomic Coordinates Reverse (-)

1833 .. 2672

Gene Structure 840 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom2303g00020.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 474 bp

ATGGTGGTGACGGGTGACGGAGAATTAGGTTGGACCTTGGGTTGGGTCGACCGGTCCGCCTCTGGTGTGCACCGGTCGGCTCGTCCCTTCTGCCGGCGATACGCTCCTGGCCTTAATTGGCCGGGTCGTGCCTCCGGCGCTGTTACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGAATACATTAGCATGGGATAACATCATAGGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCGGCGGATGTTACTTTTAGGACTCCGCCGGCACCTTATGAGAAATCAAAGTTTTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

158

Amino Acids

16.88

Weight (kDa)

10.07

Isoelectric Point (pI)

40.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002208)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G01021
pyrus_communis	pycom10g22490 pycom12554g00020 pycom12554g00070 pycom12555g00010 pycom12555g00110 pycom12555g00120 pycom12555g00200 pycom12597g00030 pycom12597g00040 pycom12597g00050 pycom2132g00040 pycom2132g00050 pycom2158g00030 pycom2158g00040 pycom2246g00010 pycom2246g00020 pycom2246g00030 pycom2246g00040 pycom2246g00090 pycom2246g00180 pycom2246g00200 pycom2247g00030 pycom2247g00060 pycom2303g00020 pycom2303g00060 pycom2303g00100 pycom2303g00130 pycom2303g00160 pycom2575g00010 pycom2575g00050 pycom280g00090 pycom280g00100 pycom280g00120 pycom420g00340 pycom520g01340 pycom553g00010 pycom553g00020 pycom581g00110 pycom961g00010
rosa_roxburghii	Rroxscaffold_118G00451770 Rroxscaffold_31G00438260 Rroxscaffold_6G00387770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	364, 445
AccI	GTMKAC	1 cut(s)	48
AciI	CCGC	4 cut(s)	57, 338, 359, 467
AclWI	GGATC	1 cut(s)	340
AcoI	YGGCCR	1 cut(s)	119
AfiI	CCNNNNNNNGG	3 cut(s)	42, 93, 334
AgeI	ACCGGT	2 cut(s)	51, 72
AgsI	TTSAA	1 cut(s)	151
AjnI	CCWGG	3 cut(s)	106, 327, 451
AjuI	GAANNNNNNNTTGG	2 cut(s)	233, 265
Alw21I	GWGCWC	2 cut(s)	72, 167
Alw26I	GTCTC	1 cut(s)	310
Alw44I	GTGCAC	1 cut(s)	68
AlwI	GGATC	1 cut(s)	340
AoxI	GGCC	2 cut(s)	109, 119
ApaLI	GTGCAC	1 cut(s)	68
AseI	ATTAAT	1 cut(s)	255
AsiGI	ACCGGT	2 cut(s)	51, 72
AspLEI	GCGC	1 cut(s)	140
AspS9I	GGNCC	2 cut(s)	33, 54
AsuC2I	CCSGG	2 cut(s)	123, 397
AsuHPI	GGTGA	2 cut(s)	19, 26
AvaII	GGWCC	2 cut(s)	33, 54
BaeGI	GKGCMC	2 cut(s)	72, 448
BanI	GGYRCC	2 cut(s)	364, 445
BanII	GRGCYC	1 cut(s)	280
BbsI	GAAGAC	1 cut(s)	289
Bbv12I	GWGCWC	2 cut(s)	72, 167
BciT130I	CCWGG	3 cut(s)	108, 329, 453
BcnI	CCSGG	2 cut(s)	123, 397
BcoDI	GTCTC	1 cut(s)	310
BfaI	CTAG	1 cut(s)	302
BfoI	RGCGCY	1 cut(s)	141
BisI	GCNGC	1 cut(s)	468
BlsI	GCNGC	1 cut(s)	469
Bme1390I	CCNGG	5 cut(s)	108, 123, 329, 397, 453
Bme18I	GGWCC	2 cut(s)	33, 54
BmgT120I	GGNCC	2 cut(s)	33, 54
BmiI	GGNNCC	4 cut(s)	366, 394, 447, 462
BmrFI	CCNGG	5 cut(s)	108, 123, 329, 397, 453
BmsI	GCATC	1 cut(s)	310
BpiI	GAAGAC	1 cut(s)	289
BpuMI	CCSGG	2 cut(s)	123, 397
BsaJI	CCNNGG	4 cut(s)	36, 240, 328, 396
BsaWI	WCCGGW	2 cut(s)	51, 72
Bsc4I	CCNNNNNNNGG	3 cut(s)	42, 93, 334
Bse118I	RCCGGY	4 cut(s)	51, 72, 93, 361
BseBI	CCWGG	3 cut(s)	108, 329, 453
BseDI	CCNNGG	4 cut(s)	36, 240, 328, 396
BseGI	GGATG	2 cut(s)	250, 346
BseLI	CCNNNNNNNGG	3 cut(s)	42, 93, 334
BseSI	GKGCMC	2 cut(s)	72, 448
Bsh1285I	CGRYCG	2 cut(s)	52, 77
BshFI	GGCC	2 cut(s)	111, 121
BshNI	GGYRCC	2 cut(s)	364, 445
BshTI	ACCGGT	2 cut(s)	51, 72
BsiEI	CGRYCG	2 cut(s)	52, 77
BsiHKAI	GWGCWC	2 cut(s)	72, 167
BsiSI	CCGG	7 cut(s)	52, 73, 94, 122, 135, 362, 396
BslFI	GGGAC	1 cut(s)	69
BslI	CCNNNNNNNGG	3 cut(s)	42, 93, 334
BsmAI	GTCTC	1 cut(s)	310
BsmFI	GGGAC	1 cut(s)	69
BsnI	GGCC	2 cut(s)	111, 121
Bsp1286I	GDGCHC	4 cut(s)	72, 167, 280, 448
Bsp143I	GATC	2 cut(s)	287, 332
BspACI	CCGC	4 cut(s)	57, 338, 359, 467
BspANI	GGCC	2 cut(s)	111, 121
BspLI	GGNNCC	4 cut(s)	366, 394, 447, 462
BspPI	GGATC	1 cut(s)	340
BspT107I	GGYRCC	2 cut(s)	364, 445
BsrFI	RCCGGY	4 cut(s)	51, 72, 93, 361
BssAI	RCCGGY	4 cut(s)	51, 72, 93, 361
BssECI	CCNNGG	4 cut(s)	36, 240, 328, 396
BssMI	GATC	2 cut(s)	287, 332
BssT1I	CCWWGG	2 cut(s)	36, 240
Bst2UI	CCWGG	3 cut(s)	108, 329, 453
Bst4CI	ACNGT	1 cut(s)	298
BstC8I	GCNNGC	4 cut(s)	95, 174, 363, 465
BstF5I	GGATG	2 cut(s)	250, 346
BstH2I	RGCGCY	1 cut(s)	141
BstHHI	GCGC	1 cut(s)	140
BstKTI	GATC	2 cut(s)	290, 335
BstMAI	GTCTC	1 cut(s)	310
BstMBI	GATC	2 cut(s)	287, 332
BstMCI	CGRYCG	2 cut(s)	52, 77
BstMWI	GCNNNNNNNGC	1 cut(s)	137
BstNI	CCWGG	3 cut(s)	108, 329, 453
BstSCI	CCNGG	5 cut(s)	106, 121, 327, 395, 451
BstSLI	GKGCMC	2 cut(s)	72, 448
BstV2I	GAAGAC	1 cut(s)	289
BsuRI	GGCC	2 cut(s)	111, 121
BtsCI	GGATG	2 cut(s)	250, 346
Cac8I	GCNNGC	4 cut(s)	95, 174, 363, 465
CfoI	GCGC	1 cut(s)	140
Cfr10I	RCCGGY	4 cut(s)	51, 72, 93, 361
Cfr13I	GGNCC	2 cut(s)	33, 54
CpoI	CGGWCCG	1 cut(s)	54
CspAI	ACCGGT	2 cut(s)	51, 72
CspI	CGGWCCG	1 cut(s)	54
CviAII	CATG	1 cut(s)	198
CviJI	RGCY	8 cut(s)	80, 111, 121, 176, 278, 418, 463, 470
CviKI_1	RGCY	8 cut(s)	80, 111, 121, 176, 278, 418, 463, 470
DpnI	GATC	2 cut(s)	289, 334
DpnII	GATC	2 cut(s)	287, 332
EaeI	YGGCCR	1 cut(s)	119
EciI	GGCGGA	3 cut(s)	46, 348, 353
Eco130I	CCWWGG	2 cut(s)	36, 240
Eco24I	GRGCYC	1 cut(s)	280
Eco47I	GGWCC	2 cut(s)	33, 54
EcoRII	CCWGG	3 cut(s)	106, 327, 451
EcoT14I	CCWWGG	2 cut(s)	36, 240
EcoT38I	GRGCYC	1 cut(s)	280
ErhI	CCWWGG	2 cut(s)	36, 240
FaeI	CATG	1 cut(s)	201
FaiI	YATR	5 cut(s)	199, 212, 314, 372, 407
FaqI	GGGAC	1 cut(s)	69
FatI	CATG	1 cut(s)	197
FblI	GTMKAC	1 cut(s)	48
Fnu4HI	GCNGC	1 cut(s)	468
FokI	GGATG	2 cut(s)	257, 353
FriOI	GRGCYC	1 cut(s)	280
Fsp4HI	GCNGC	1 cut(s)	468
FspBI	CTAG	1 cut(s)	302
GlaI	GCGC	1 cut(s)	139
GluI	GCNGC	1 cut(s)	468
HaeII	RGCGCY	1 cut(s)	141
HaeIII	GGCC	2 cut(s)	111, 121
HapII	CCGG	7 cut(s)	52, 73, 94, 122, 135, 362, 396
HhaI	GCGC	1 cut(s)	140
Hin1II	CATG	1 cut(s)	201
Hin6I	GCGC	1 cut(s)	138
HinP1I	GCGC	1 cut(s)	138
HincII	GTYRAC	1 cut(s)	49
HindII	GTYRAC	1 cut(s)	49
HinfI	GANTC	1 cut(s)	355
HpaII	CCGG	7 cut(s)	52, 73, 94, 122, 135, 362, 396
HphI	GGTGA	2 cut(s)	19, 26
Hpy166II	GTNNAC	2 cut(s)	49, 70
Hpy188I	TCNGA	2 cut(s)	186, 292
Hpy188III	TCNNGA	1 cut(s)	260
Hpy8I	GTNNAC	2 cut(s)	49, 70
HpyAV	CCTTC	2 cut(s)	97, 435
HpyCH4III	ACNGT	1 cut(s)	298
HpyCH4V	TGCA	1 cut(s)	70
HpyF10VI	GCNNNNNNNGC	1 cut(s)	137
Hsp92II	CATG	1 cut(s)	201
HspAI	GCGC	1 cut(s)	138
KroI	GCCGGC	2 cut(s)	93, 361
KroNI	GCCGGC	2 cut(s)	95, 363
Kzo9I	GATC	2 cut(s)	287, 332
LmnI	GCTCC	2 cut(s)	109, 460
LweI	GCATC	1 cut(s)	310
MaeI	CTAG	1 cut(s)	302
MaeIII	GTNAC	4 cut(s)	7, 14, 142, 343
MalI	GATC	2 cut(s)	289, 334
MboI	GATC	2 cut(s)	287, 332
MboII	GAAGA	2 cut(s)	163, 294
MhlI	GDGCHC	4 cut(s)	72, 167, 280, 448
MluCI	AATT	4 cut(s)	23, 115, 155, 432
MlyI	GAGTC	1 cut(s)	349
MmeI	TCCRAC	1 cut(s)	11
MnlI	CCTC	2 cut(s)	70, 142
MroNI	GCCGGC	2 cut(s)	93, 361
MseI	TTAA	4 cut(s)	114, 255, 426, 472
MslI	CAYNNNNRTG	1 cut(s)	196
MspI	CCGG	7 cut(s)	52, 73, 94, 122, 135, 362, 396
MspR9I	CCNGG	5 cut(s)	108, 123, 329, 397, 453
MvaI	CCWGG	3 cut(s)	108, 329, 453
MwoI	GCNNNNNNNGC	1 cut(s)	137
NaeI	GCCGGC	2 cut(s)	95, 363
NciI	CCSGG	2 cut(s)	123, 397
NdeII	GATC	2 cut(s)	287, 332
NgoMIV	GCCGGC	2 cut(s)	93, 361
NlaIII	CATG	1 cut(s)	201
NlaIV	GGNNCC	4 cut(s)	366, 394, 447, 462
NmuCI	GTSAC	2 cut(s)	7, 14
PdiI	GCCGGC	2 cut(s)	95, 363
PinAI	ACCGGT	2 cut(s)	51, 72
PkrI	GCNGC	1 cut(s)	469
PleI	GAGTC	1 cut(s)	349
PpsI	GAGTC	1 cut(s)	349
PshBI	ATTAAT	1 cut(s)	255
Psp6I	CCWGG	3 cut(s)	106, 327, 451
PspGI	CCWGG	3 cut(s)	106, 327, 451
PspN4I	GGNNCC	4 cut(s)	366, 394, 447, 462
PspPI	GGNCC	2 cut(s)	33, 54
RseI	CAYNNNNRTG	1 cut(s)	196
Rsr2I	CGGWCCG	1 cut(s)	54
RsrII	CGGWCCG	1 cut(s)	54
SalI	GTCGAC	1 cut(s)	47
SaqAI	TTAA	4 cut(s)	114, 255, 426, 472
SatI	GCNGC	1 cut(s)	468
Sau3AI	GATC	2 cut(s)	287, 332
Sau96I	GGNCC	2 cut(s)	33, 54
SchI	GAGTC	1 cut(s)	349
ScrFI	CCNGG	5 cut(s)	108, 123, 329, 397, 453
SduI	GDGCHC	4 cut(s)	72, 167, 280, 448
SetI	ASST	3 cut(s)	31, 38, 370
SfaNI	GCATC	1 cut(s)	310
SinI	GGWCC	2 cut(s)	33, 54
SmiMI	CAYNNNNRTG	1 cut(s)	196
Sse9I	AATT	4 cut(s)	23, 115, 155, 432
SsiI	CCGC	4 cut(s)	57, 338, 359, 467
SspMI	CTAG	1 cut(s)	302
StyD4I	CCNGG	5 cut(s)	106, 121, 327, 395, 451
StyI	CCWWGG	2 cut(s)	36, 240
TaaI	ACNGT	1 cut(s)	298
TaqI	TCGA	2 cut(s)	48, 280
TasI	AATT	4 cut(s)	23, 115, 155, 432
TauI	GCSGC	1 cut(s)	470
Tru1I	TTAA	4 cut(s)	114, 255, 426, 472
Tru9I	TTAA	4 cut(s)	114, 255, 426, 472
TseFI	GTSAC	2 cut(s)	7, 14
Tsp45I	GTSAC	2 cut(s)	7, 14
TspDTI	ATGAA	1 cut(s)	241
TspGWI	ACGGA	2 cut(s)	33, 453
VneI	GTGCAC	1 cut(s)	68
VpaK11BI	GGWCC	2 cut(s)	33, 54
VspI	ATTAAT	1 cut(s)	255
XmiI	GTMKAC	1 cut(s)	48
XspI	CTAG	1 cut(s)	302

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.