Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

SuperScaffold_420

Orthogroup ID

OG0002208

Physical Location & Seq

Genomic Coordinates Reverse (-)

442514 .. 442924

Gene Structure 411 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom420g00340.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 369 bp

ATGATCCTTCCGCAGGGCACGCTTGCCTGGGCGTCACACGCCGTTGCCCCCCCACGCCTCCCTCGGGAGCGTGGGGGAGCGGACGATGGCCTCCCGTGCGTCACCCCGCGCGGTTGGCGCAAATGCCGGGTGCTCGGCGACGAACGCCACGACAATCGGTGGTTGTCGAACCTCGGTTGCCCGTTGTGCGCCTTCGTCGCGCTCCGAGCGGCCCGCGACGCTCCCCGCTCTGCTTCGGCCGAGCTTTCAACGCGACCCCAGGTCAGGCGGGGTTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACGTGGATTCCCCTAGTAACGGCGAGCGAACTGGGAACAGCCCAGCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

123

Amino Acids

13.16

Weight (kDa)

9.77

Isoelectric Point (pI)

44.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002208)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G01021
pyrus_communis	pycom10g22490 pycom12554g00020 pycom12554g00070 pycom12555g00010 pycom12555g00110 pycom12555g00120 pycom12555g00200 pycom12597g00030 pycom12597g00040 pycom12597g00050 pycom2132g00040 pycom2132g00050 pycom2158g00030 pycom2158g00040 pycom2246g00010 pycom2246g00020 pycom2246g00030 pycom2246g00040 pycom2246g00090 pycom2246g00180 pycom2246g00200 pycom2247g00030 pycom2247g00060 pycom2303g00020 pycom2303g00060 pycom2303g00100 pycom2303g00130 pycom2303g00160 pycom2575g00010 pycom2575g00050 pycom280g00090 pycom280g00100 pycom280g00120 pycom420g00340 pycom520g01340 pycom553g00010 pycom553g00020 pycom581g00110 pycom961g00010
rosa_roxburghii	Rroxscaffold_118G00451770 Rroxscaffold_31G00438260 Rroxscaffold_6G00387770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	3 cut(s)	80, 209, 228
AccII	CGCG	5 cut(s)	109, 111, 200, 216, 253
AcoI	YGGCCR	1 cut(s)	237
AcsI	RAATTY	1 cut(s)	283
AcyI	GRCGYC	1 cut(s)	32
AfiI	CCNNNNNNNGG	4 cut(s)	13, 64, 264, 338
AgsI	TTSAA	1 cut(s)	249
AhdI	GACNNNNNGTC	1 cut(s)	260
AjnI	CCWGG	2 cut(s)	26, 258
AluBI	AGCT	2 cut(s)	244, 365
AluI	AGCT	2 cut(s)	244, 365
Alw21I	GWGCWC	1 cut(s)	135
Ama87I	CYCGRG	1 cut(s)	63
AoxI	GGCC	3 cut(s)	88, 210, 237
ApoI	RAATTY	1 cut(s)	283
AspLEI	GCGC	4 cut(s)	111, 120, 191, 202
AspS9I	GGNCC	1 cut(s)	211
AsuC2I	CCSGG	1 cut(s)	128
AsuHPI	GGTGA	1 cut(s)	94
AvaI	CYCGRG	1 cut(s)	63
BaeGI	GKGCMC	1 cut(s)	20
Bbv12I	GWGCWC	1 cut(s)	135
BccI	CCATC	1 cut(s)	80
BceAI	ACGGC	2 cut(s)	26, 355
BciT130I	CCWGG	2 cut(s)	28, 260
BcnI	CCSGG	1 cut(s)	128
BfaI	CTAG	1 cut(s)	333
BisI	GCNGC	1 cut(s)	210
BlsI	GCNGC	1 cut(s)	211
Bme1390I	CCNGG	3 cut(s)	28, 128, 260
BmeRI	GACNNNNNGTC	1 cut(s)	260
BmeT110I	CYCGRG	1 cut(s)	63
BmgT120I	GGNCC	1 cut(s)	211
BmrFI	CCNGG	3 cut(s)	28, 128, 260
BmrI	ACTGGG	1 cut(s)	360
BmuI	ACTGGG	1 cut(s)	360
BpuMI	CCSGG	1 cut(s)	128
BsaAI	YACGTR	1 cut(s)	322
BsaHI	GRCGYC	1 cut(s)	32
BsaJI	CCNNGG	4 cut(s)	27, 62, 172, 258
Bsc4I	CCNNNNNNNGG	4 cut(s)	13, 64, 264, 338
Bse1I	ACTGG	1 cut(s)	355
BseBI	CCWGG	2 cut(s)	28, 260
BseDI	CCNNGG	4 cut(s)	27, 62, 172, 258
BseLI	CCNNNNNNNGG	4 cut(s)	13, 64, 264, 338
BseNI	ACTGG	1 cut(s)	355
BseSI	GKGCMC	1 cut(s)	20
BseX3I	CGGCCG	1 cut(s)	237
BseYI	CCCAGC	1 cut(s)	361
Bsh1236I	CGCG	5 cut(s)	109, 111, 200, 216, 253
Bsh1285I	CGRYCG	1 cut(s)	240
BshFI	GGCC	3 cut(s)	90, 212, 239
BsiEI	CGRYCG	1 cut(s)	240
BsiHKAI	GWGCWC	1 cut(s)	135
BsiHKCI	CYCGRG	1 cut(s)	63
BsiSI	CCGG	1 cut(s)	127
BslI	CCNNNNNNNGG	4 cut(s)	13, 64, 264, 338
BsnI	GGCC	3 cut(s)	90, 212, 239
BsoBI	CYCGRG	1 cut(s)	63
Bsp1286I	GDGCHC	2 cut(s)	20, 135
Bsp143I	GATC	1 cut(s)	3
BspANI	GGCC	3 cut(s)	90, 212, 239
BspFNI	CGCG	5 cut(s)	109, 111, 200, 216, 253
BsrBI	CCGCTC	3 cut(s)	80, 209, 228
BsrI	ACTGG	1 cut(s)	355
BssECI	CCNNGG	4 cut(s)	27, 62, 172, 258
BssMI	GATC	1 cut(s)	3
BssNI	GRCGYC	1 cut(s)	32
Bst2UI	CCWGG	2 cut(s)	28, 260
BstACI	GRCGYC	1 cut(s)	32
BstBAI	YACGTR	1 cut(s)	322
BstC8I	GCNNGC	4 cut(s)	20, 24, 214, 344
BstEII	GGTNACC	1 cut(s)	272
BstENI	CCTNNNNNAGG	1 cut(s)	11
BstFNI	CGCG	5 cut(s)	109, 111, 200, 216, 253
BstHHI	GCGC	4 cut(s)	111, 120, 191, 202
BstKTI	GATC	1 cut(s)	6
BstMBI	GATC	1 cut(s)	3
BstMCI	CGRYCG	1 cut(s)	240
BstNI	CCWGG	2 cut(s)	28, 260
BstPI	GGTNACC	1 cut(s)	272
BstSCI	CCNGG	3 cut(s)	26, 126, 258
BstSLI	GKGCMC	1 cut(s)	20
BstUI	CGCG	5 cut(s)	109, 111, 200, 216, 253
BstZI	CGGCCG	1 cut(s)	237
BsuRI	GGCC	3 cut(s)	90, 212, 239
Cac8I	GCNNGC	4 cut(s)	20, 24, 214, 344
CfoI	GCGC	4 cut(s)	111, 120, 191, 202
Cfr13I	GGNCC	1 cut(s)	211
CseI	GACGC	3 cut(s)	21, 88, 227
CviJI	RGCY	6 cut(s)	90, 212, 239, 244, 360, 365
CviKI_1	RGCY	6 cut(s)	90, 212, 239, 244, 360, 365
DpnI	GATC	1 cut(s)	5
DpnII	GATC	1 cut(s)	3
DriI	GACNNNNNGTC	1 cut(s)	260
EaeI	YGGCCR	1 cut(s)	237
EagI	CGGCCG	1 cut(s)	237
Eam1105I	GACNNNNNGTC	1 cut(s)	260
EclXI	CGGCCG	1 cut(s)	237
Eco52I	CGGCCG	1 cut(s)	237
Eco88I	CYCGRG	1 cut(s)	63
Eco91I	GGTNACC	1 cut(s)	272
EcoNI	CCTNNNNNAGG	1 cut(s)	11
EcoO65I	GGTNACC	1 cut(s)	272
EcoRII	CCWGG	2 cut(s)	26, 258
FaiI	YATR	1 cut(s)	293
FauI	CCCGC	5 cut(s)	114, 221, 233, 261, 285
Fnu4HI	GCNGC	1 cut(s)	210
Fsp4HI	GCNGC	1 cut(s)	210
FspBI	CTAG	1 cut(s)	333
GlaI	GCGC	4 cut(s)	110, 119, 190, 201
GluI	GCNGC	1 cut(s)	210
GsaI	CCCAGC	1 cut(s)	365
HaeIII	GGCC	3 cut(s)	90, 212, 239
HapII	CCGG	1 cut(s)	127
HgaI	GACGC	3 cut(s)	21, 88, 227
HhaI	GCGC	4 cut(s)	111, 120, 191, 202
Hin1I	GRCGYC	1 cut(s)	32
Hin6I	GCGC	4 cut(s)	109, 118, 189, 200
HinP1I	GCGC	4 cut(s)	109, 118, 189, 200
HinfI	GANTC	1 cut(s)	326
HpaII	CCGG	1 cut(s)	127
HphI	GGTGA	1 cut(s)	94
Hpy188I	TCNGA	1 cut(s)	206
Hpy188III	TCNNGA	1 cut(s)	65
Hpy99I	CGWCG	3 cut(s)	143, 200, 221
HpyAV	CCTTC	2 cut(s)	17, 202
HpyCH4IV	ACGT	1 cut(s)	321
HpySE526I	ACGT	1 cut(s)	321
Hsp92I	GRCGYC	1 cut(s)	32
HspAI	GCGC	4 cut(s)	109, 118, 189, 200
Kzo9I	GATC	1 cut(s)	3
LmnI	GCTCC	4 cut(s)	67, 77, 207, 226
LpnPI	CCDG	7 cut(s)	13, 40, 140, 245, 250, 272, 336
MaeI	CTAG	1 cut(s)	333
MaeII	ACGT	1 cut(s)	321
MaeIII	GTNAC	4 cut(s)	33, 100, 272, 335
MalI	GATC	1 cut(s)	5
MbiI	CCGCTC	3 cut(s)	80, 209, 228
MboI	GATC	1 cut(s)	3
MhlI	GDGCHC	2 cut(s)	20, 135
MluCI	AATT	1 cut(s)	283
MnlI	CCTC	5 cut(s)	68, 72, 101, 182, 299
MseI	TTAA	1 cut(s)	287
MspA1I	CMGCKG	1 cut(s)	280
MspI	CCGG	1 cut(s)	127
MspR9I	CCNGG	3 cut(s)	28, 128, 260
MvaI	CCWGG	2 cut(s)	28, 260
MvnI	CGCG	5 cut(s)	109, 111, 200, 216, 253
NciI	CCSGG	1 cut(s)	128
NdeII	GATC	1 cut(s)	3
NmeAIII	GCCGAG	2 cut(s)	114, 265
NmuCI	GTSAC	2 cut(s)	33, 100
PcsI	WCGNNNNNNNCGW	1 cut(s)	147
PfeI	GAWTC	1 cut(s)	326
PkrI	GCNGC	1 cut(s)	211
Ppu21I	YACGTR	1 cut(s)	322
Psp6I	CCWGG	2 cut(s)	26, 258
PspEI	GGTNACC	1 cut(s)	272
PspFI	CCCAGC	1 cut(s)	361
PspGI	CCWGG	2 cut(s)	26, 258
PspPI	GGNCC	1 cut(s)	211
SaqAI	TTAA	1 cut(s)	287
SatI	GCNGC	1 cut(s)	210
Sau3AI	GATC	1 cut(s)	3
Sau96I	GGNCC	1 cut(s)	211
ScrFI	CCNGG	3 cut(s)	28, 128, 260
SduI	GDGCHC	2 cut(s)	20, 135
SetI	ASST	5 cut(s)	174, 246, 264, 324, 367
Sse9I	AATT	1 cut(s)	283
SspMI	CTAG	1 cut(s)	333
StyD4I	CCNGG	3 cut(s)	26, 126, 258
TaiI	ACGT	1 cut(s)	324
TaqI	TCGA	1 cut(s)	167
TasI	AATT	1 cut(s)	283
TauI	GCSGC	1 cut(s)	212
TfiI	GAWTC	1 cut(s)	326
Tru1I	TTAA	1 cut(s)	287
Tru9I	TTAA	1 cut(s)	287
TseFI	GTSAC	2 cut(s)	33, 100
Tsp45I	GTSAC	2 cut(s)	33, 100
XagI	CCTNNNNNAGG	1 cut(s)	11
XapI	RAATTY	1 cut(s)	283
XspI	CTAG	1 cut(s)	333

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.