Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000118

Orthogroup ID

OG0002208

Physical Location & Seq

Genomic Coordinates Reverse (-)

13 .. 1115

Gene Structure 1103 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_118G00451770.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGTACGACGCCGTGCTCGTTGCAGGGTCTCCCTACGCGGTGCCGCCGTTGTCAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

55

Amino Acids

6.13

Weight (kDa)

8.52

Isoelectric Point (pI)

50.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002208)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G01021
pyrus_communis	pycom10g22490 pycom12554g00020 pycom12554g00070 pycom12555g00010 pycom12555g00110 pycom12555g00120 pycom12555g00200 pycom12597g00030 pycom12597g00040 pycom12597g00050 pycom2132g00040 pycom2132g00050 pycom2158g00030 pycom2158g00040 pycom2246g00010 pycom2246g00020 pycom2246g00030 pycom2246g00040 pycom2246g00090 pycom2246g00180 pycom2246g00200 pycom2247g00030 pycom2247g00060 pycom2303g00020 pycom2303g00060 pycom2303g00100 pycom2303g00130 pycom2303g00160 pycom2575g00010 pycom2575g00050 pycom280g00090 pycom280g00100 pycom280g00120 pycom420g00340 pycom520g01340 pycom553g00010 pycom553g00020 pycom581g00110 pycom961g00010
rosa_roxburghii	Rroxscaffold_118G00451770 Rroxscaffold_31G00438260 Rroxscaffold_6G00387770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	40
AccII	CGCG	1 cut(s)	38
AciI	CCGC	2 cut(s)	38, 44
AclWI	GGATC	1 cut(s)	68
AcyI	GRCGYC	1 cut(s)	9
AfaI	GTAC	1 cut(s)	5
AjnI	CCWGG	1 cut(s)	66
Alw21I	GWGCWC	1 cut(s)	18
Alw26I	GTCTC	2 cut(s)	33, 103
AlwI	GGATC	1 cut(s)	68
Asp700I	GAANNNNTTC	1 cut(s)	135
BanI	GGYRCC	1 cut(s)	40
Bbv12I	GWGCWC	1 cut(s)	18
BceAI	ACGGC	1 cut(s)	31
BciT130I	CCWGG	1 cut(s)	68
BcoDI	GTCTC	2 cut(s)	33, 103
BisI	GCNGC	1 cut(s)	44
BlsI	GCNGC	1 cut(s)	45
Bme1390I	CCNGG	1 cut(s)	68
BmiI	GGNNCC	1 cut(s)	42
BmrFI	CCNGG	1 cut(s)	68
BsaHI	GRCGYC	1 cut(s)	9
BsaI	GGTCTC	1 cut(s)	33
Bse1I	ACTGG	1 cut(s)	81
BseBI	CCWGG	1 cut(s)	68
BseNI	ACTGG	1 cut(s)	81
Bsh1236I	CGCG	1 cut(s)	38
BshNI	GGYRCC	1 cut(s)	40
BsiHKAI	GWGCWC	1 cut(s)	18
BsmAI	GTCTC	2 cut(s)	33, 103
BsmI	GAATGC	1 cut(s)	65
Bso31I	GGTCTC	1 cut(s)	33
Bsp1286I	GDGCHC	1 cut(s)	18
Bsp143I	GATC	1 cut(s)	73
BspACI	CCGC	2 cut(s)	38, 44
BspFNI	CGCG	1 cut(s)	38
BspLI	GGNNCC	1 cut(s)	42
BspPI	GGATC	1 cut(s)	68
BspT107I	GGYRCC	1 cut(s)	40
BspTNI	GGTCTC	1 cut(s)	33
BsrI	ACTGG	1 cut(s)	81
BssMI	GATC	1 cut(s)	73
BssNI	GRCGYC	1 cut(s)	9
Bst2UI	CCWGG	1 cut(s)	68
Bst4CI	ACNGT	1 cut(s)	145
BstACI	GRCGYC	1 cut(s)	9
BstFNI	CGCG	1 cut(s)	38
BstKTI	GATC	1 cut(s)	76
BstMAI	GTCTC	2 cut(s)	33, 103
BstMBI	GATC	1 cut(s)	73
BstNI	CCWGG	1 cut(s)	68
BstNSI	RCATGY	1 cut(s)	121
BstSCI	CCNGG	1 cut(s)	66
BstUI	CGCG	1 cut(s)	38
CseI	GACGC	1 cut(s)	17
CsiI	ACCWGGT	1 cut(s)	66
Csp6I	GTAC	1 cut(s)	4
CviAII	CATG	2 cut(s)	114, 118
CviJI	RGCY	2 cut(s)	112, 161
CviKI_1	RGCY	2 cut(s)	112, 161
CviQI	GTAC	1 cut(s)	4
DpnI	GATC	1 cut(s)	75
DpnII	GATC	1 cut(s)	73
Eco31I	GGTCTC	1 cut(s)	33
EcoRII	CCWGG	1 cut(s)	66
EcoT22I	ATGCAT	1 cut(s)	119
FaeI	CATG	2 cut(s)	117, 121
FaiI	YATR	5 cut(s)	90, 92, 115, 119, 129
FatI	CATG	2 cut(s)	113, 117
FauNDI	CATATG	1 cut(s)	90
Fnu4HI	GCNGC	1 cut(s)	44
Fsp4HI	GCNGC	1 cut(s)	44
GluI	GCNGC	1 cut(s)	44
HgaI	GACGC	1 cut(s)	17
Hin1I	GRCGYC	1 cut(s)	9
Hin1II	CATG	2 cut(s)	117, 121
Hpy188I	TCNGA	1 cut(s)	141
Hpy99I	CGWCG	1 cut(s)	11
HpyCH4III	ACNGT	1 cut(s)	145
HpyCH4V	TGCA	2 cut(s)	23, 117
Hsp92I	GRCGYC	1 cut(s)	9
Hsp92II	CATG	2 cut(s)	117, 121
Kzo9I	GATC	1 cut(s)	73
LpnPI	CCDG	5 cut(s)	9, 53, 80, 90, 94
MabI	ACCWGGT	1 cut(s)	66
MalI	GATC	1 cut(s)	75
MboI	GATC	1 cut(s)	73
MhlI	GDGCHC	1 cut(s)	18
MluCI	AATT	1 cut(s)	135
Mph1103I	ATGCAT	1 cut(s)	119
MroXI	GAANNNNTTC	1 cut(s)	135
MseI	TTAA	2 cut(s)	108, 166
MslI	CAYNNNNRTG	1 cut(s)	118
MspR9I	CCNGG	1 cut(s)	68
Mva1269I	GAATGC	1 cut(s)	65
MvaI	CCWGG	1 cut(s)	68
MvnI	CGCG	1 cut(s)	38
NdeI	CATATG	1 cut(s)	90
NdeII	GATC	1 cut(s)	73
NlaIII	CATG	2 cut(s)	117, 121
NlaIV	GGNNCC	1 cut(s)	42
NsiI	ATGCAT	1 cut(s)	119
NspI	RCATGY	1 cut(s)	121
PcsI	WCGNNNNNNNCGW	1 cut(s)	15
PctI	GAATGC	1 cut(s)	65
PdmI	GAANNNNTTC	1 cut(s)	135
PkrI	GCNGC	1 cut(s)	45
Psp6I	CCWGG	1 cut(s)	66
PspGI	CCWGG	1 cut(s)	66
PspN4I	GGNNCC	1 cut(s)	42
RsaI	GTAC	1 cut(s)	5
RsaNI	GTAC	1 cut(s)	4
RseI	CAYNNNNRTG	1 cut(s)	118
SaqAI	TTAA	2 cut(s)	108, 166
SatI	GCNGC	1 cut(s)	44
Sau3AI	GATC	1 cut(s)	73
ScrFI	CCNGG	1 cut(s)	68
SduI	GDGCHC	1 cut(s)	18
SetI	ASST	1 cut(s)	69
SexAI	ACCWGGT	1 cut(s)	66
SmiMI	CAYNNNNRTG	1 cut(s)	118
Sse9I	AATT	1 cut(s)	135
SsiI	CCGC	2 cut(s)	38, 44
StyD4I	CCNGG	1 cut(s)	66
TaaI	ACNGT	1 cut(s)	145
TasI	AATT	1 cut(s)	135
TauI	GCSGC	1 cut(s)	46
Tru1I	TTAA	2 cut(s)	108, 166
Tru9I	TTAA	2 cut(s)	108, 166
TspDTI	ATGAA	1 cut(s)	144
XceI	RCATGY	1 cut(s)	121
XmnI	GAANNNNTTC	1 cut(s)	135
Zsp2I	ATGCAT	1 cut(s)	119

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.