RchiOBHm_Chr2g0131671

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
48048767 .. 48053103
4337 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 282 bp
ATGGAGTTTTGGGACAAGATGATCTTCCCTGTCCGCCGTGTCTGGCTTGCTGTCTCTACTCGTGTTAAGGCTCGCAAAAATGGTGCTGGTCTGTTGAAGCTTCACGACGATGTACAAACTTGTGGCTATCAAGATGTGCAAGTGATGTGGCAGATGCTGAGCAGAGAAGCTGAGCTGATAAATCACCACCATGCCAAACGTAAACAGCGACCCTTCTGGAGAGTTTTTGAATGGTCTAACAACCATAGTAAAGCCTCGTCCCTCTCTGCAAATCATGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

11.04

Weight (kDa)

10.21

Isoelectric Point (pI)

32.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 34
AfaI GTAC 1 cut(s) 114
AgsI TTSAA 2 cut(s) 97, 230
AluBI AGCT 3 cut(s) 100, 170, 175
AluI AGCT 3 cut(s) 100, 170, 175
Alw26I GTCTC 1 cut(s) 58
AlwNI CAGNNNCTG 1 cut(s) 157
AsuHPI GGTGA 1 cut(s) 176
BauI CACGAG 1 cut(s) 60
BceAI ACGGC 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 58
BlpI GCTNAGC 2 cut(s) 158, 171
BmsI GCATC 1 cut(s) 144
BpmI CTGGAG 1 cut(s) 238
Bpu1102I GCTNAGC 2 cut(s) 158, 171
BseMII CTCAG 2 cut(s) 149, 162
BslFI GGGAC 2 cut(s) 26, 244
BsmAI GTCTC 1 cut(s) 58
BsmFI GGGAC 2 cut(s) 26, 244
Bsp1407I TGTACA 1 cut(s) 112
Bsp143I GATC 1 cut(s) 21
Bsp1720I GCTNAGC 2 cut(s) 158, 171
BspACI CCGC 1 cut(s) 34
BspCNI CTCAG 2 cut(s) 150, 163
BsrGI TGTACA 1 cut(s) 112
BssMI GATC 1 cut(s) 21
BssSI CACGAG 1 cut(s) 60
Bst2BI CACGAG 1 cut(s) 60
BstAPI GCANNNNNTGC 1 cut(s) 275
BstAUI TGTACA 1 cut(s) 112
BstC8I GCNNGC 2 cut(s) 48, 73
BstDEI CTNAG 2 cut(s) 158, 171
BstKTI GATC 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 58
BstMBI GATC 1 cut(s) 21
BstMWI GCNNNNNNNGC 1 cut(s) 275
Cac8I GCNNGC 2 cut(s) 48, 73
CaiI CAGNNNCTG 1 cut(s) 157
Csp6I GTAC 1 cut(s) 113
CspCI CAANNNNNGTGG 2 cut(s) 128, 163
CviAII CATG 2 cut(s) 191, 275
CviJI RGCY 7 cut(s) 46, 71, 100, 126, 170, 175, 254
CviKI_1 RGCY 7 cut(s) 46, 71, 100, 126, 170, 175, 254
CviQI GTAC 1 cut(s) 113
DdeI CTNAG 2 cut(s) 158, 171
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
EciI GGCGGA 1 cut(s) 23
FaeI CATG 2 cut(s) 194, 278
FaiI YATR 3 cut(s) 192, 246, 276
FalI AAGNNNNNCTT 2 cut(s) 8, 40
FaqI GGGAC 2 cut(s) 26, 244
FatI CATG 2 cut(s) 190, 274
GsuI CTGGAG 1 cut(s) 238
Hin1II CATG 2 cut(s) 194, 278
HindIII AAGCTT 1 cut(s) 98
HphI GGTGA 1 cut(s) 176
Hpy166II GTNNAC 1 cut(s) 203
Hpy188III TCNNGA 3 cut(s) 104, 131, 217
Hpy8I GTNNAC 1 cut(s) 203
Hpy99I CGWCG 1 cut(s) 110
HpyAV CCTTC 1 cut(s) 223
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 2 cut(s) 139, 269
HpyF10VI GCNNNNNNNGC 1 cut(s) 275
HpyF3I CTNAG 2 cut(s) 158, 171
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 2 cut(s) 194, 278
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 4 cut(s) 28, 42, 72, 202
LweI GCATC 1 cut(s) 144
MaeII ACGT 1 cut(s) 199
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 1 cut(s) 16
MnlI CCTC 2 cut(s) 265, 272
MseI TTAA 1 cut(s) 66
MslI CAYNNNNRTG 2 cut(s) 108, 189
MwoI GCNNNNNNNGC 1 cut(s) 275
NdeII GATC 1 cut(s) 21
NlaIII CATG 2 cut(s) 194, 278
PcsI WCGNNNNNNNCGW 1 cut(s) 205
PstNI CAGNNNCTG 1 cut(s) 157
RsaI GTAC 1 cut(s) 114
RsaNI GTAC 1 cut(s) 113
RseI CAYNNNNRTG 2 cut(s) 108, 189
SaqAI TTAA 1 cut(s) 66
Sau3AI GATC 1 cut(s) 21
SetI ASST 4 cut(s) 102, 172, 177, 202
SfaNI GCATC 1 cut(s) 144
SmiMI CAYNNNNRTG 2 cut(s) 108, 189
SsiI CCGC 1 cut(s) 34
TaiI ACGT 1 cut(s) 202
TatI WGTACW 1 cut(s) 112
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.