RchiOBHm_Chr2g0139931

ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
57355164 .. 57355526
363 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 363 bp
ATGACTTACAGACTTTTCAAGGACCTGATTCAAAACAATGAAGAATTTCTTATGCAGAAAACTGGCGAAACAAAGAACTCTGTGTTGCACCTTGCTGCAAGGTTCGGTCACATTGAGCTACTTGCCTTTATCATTGAGCTACTTCCTGACTTGGTTTCTATTGGAAACATCAAGGGTGAAACTCCGTTACACGAAACTTGTTGCCAAGGGAATACCAATGTTGTGAAGCTGCTGGTAGAGGCCAATCCATATGTGATTGGTACTCTTAACCATGAAATGCAAGCTGCTTTTTACATAGCCTGCAGTTATAGGCATGTTGATGTTGTCAAGTACATGGCACCAACCAGGGGTGTTAGACTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.59

Weight (kDa)

6.5

Isoelectric Point (pI)

25.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ank_2 PF12796 5 - 81 7.4e-10 Ankyrin repeats (3 copies)
Ank_2 PF12796 29 - 113 7.9e-13 Ankyrin repeats (3 copies)
Ank_4 PF13637 29 - 79 4.6e-06 Ankyrin repeats (many copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 337
AcsI RAATTY 1 cut(s) 44
AfaI GTAC 2 cut(s) 262, 332
AfiI CCNNNNNNNGG 1 cut(s) 347
AgsI TTSAA 2 cut(s) 19, 32
AjnI CCWGG 1 cut(s) 344
AluBI AGCT 4 cut(s) 118, 139, 229, 284
AluI AGCT 4 cut(s) 118, 139, 229, 284
AoxI GGCC 1 cut(s) 240
ApeKI GCWGC 3 cut(s) 95, 229, 284
ApoI RAATTY 1 cut(s) 44
Asp700I GAANNNNTTC 1 cut(s) 45
AspS9I GGNCC 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 188
AvaII GGWCC 1 cut(s) 22
BanI GGYRCC 1 cut(s) 337
BbvI GCAGC 3 cut(s) 82, 216, 271
BciT130I CCWGG 1 cut(s) 346
BfmI CTRYAG 1 cut(s) 301
BisI GCNGC 3 cut(s) 96, 230, 285
BlsI GCNGC 3 cut(s) 97, 231, 286
Bme1390I CCNGG 1 cut(s) 346
Bme18I GGWCC 1 cut(s) 22
BmgT120I GGNCC 1 cut(s) 22
BmiI GGNNCC 1 cut(s) 339
BmrFI CCNGG 1 cut(s) 346
BsaJI CCNNGG 2 cut(s) 205, 345
Bsc4I CCNNNNNNNGG 1 cut(s) 347
Bse1I ACTGG 1 cut(s) 67
BseBI CCWGG 1 cut(s) 346
BseDI CCNNGG 2 cut(s) 205, 345
BseLI CCNNNNNNNGG 1 cut(s) 347
BseNI ACTGG 1 cut(s) 67
BseXI GCAGC 3 cut(s) 82, 216, 271
BshFI GGCC 1 cut(s) 242
BshNI GGYRCC 1 cut(s) 337
BslI CCNNNNNNNGG 1 cut(s) 347
BsnI GGCC 1 cut(s) 242
BspANI GGCC 1 cut(s) 242
BspLI GGNNCC 1 cut(s) 339
BspMAI CTGCAG 1 cut(s) 305
BspT107I GGYRCC 1 cut(s) 337
BsrI ACTGG 1 cut(s) 67
BssECI CCNNGG 2 cut(s) 205, 345
BssT1I CCWWGG 1 cut(s) 205
Bst2UI CCWGG 1 cut(s) 346
BstC8I GCNNGC 2 cut(s) 282, 301
BstNI CCWGG 1 cut(s) 346
BstNSI RCATGY 1 cut(s) 317
BstSCI CCNGG 1 cut(s) 344
BstSFI CTRYAG 1 cut(s) 301
BstV1I GCAGC 3 cut(s) 82, 216, 271
BsuRI GGCC 1 cut(s) 242
Cac8I GCNNGC 2 cut(s) 282, 301
Cfr13I GGNCC 1 cut(s) 22
Csp6I GTAC 2 cut(s) 261, 331
CviAII CATG 3 cut(s) 272, 314, 334
CviJI RGCY 6 cut(s) 118, 139, 229, 242, 284, 299
CviKI_1 RGCY 6 cut(s) 118, 139, 229, 242, 284, 299
CviQI GTAC 2 cut(s) 261, 331
Eco130I CCWWGG 1 cut(s) 205
Eco47I GGWCC 1 cut(s) 22
EcoO109I RGGNCCY 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 344
EcoT14I CCWWGG 1 cut(s) 205
ErhI CCWWGG 1 cut(s) 205
FaeI CATG 3 cut(s) 275, 317, 337
FaiI YATR 8 cut(s) 53, 250, 252, 273, 296, 309, 315, 335
FalI AAGNNNNNCTT 2 cut(s) 33, 65
FatI CATG 3 cut(s) 271, 313, 333
FauNDI CATATG 1 cut(s) 250
Fnu4HI GCNGC 3 cut(s) 96, 230, 285
Fsp4HI GCNGC 3 cut(s) 96, 230, 285
GluI GCNGC 3 cut(s) 96, 230, 285
HaeIII GGCC 1 cut(s) 242
Hin1II CATG 3 cut(s) 275, 317, 337
HinfI GANTC 2 cut(s) 28, 357
HphI GGTGA 1 cut(s) 188
Hpy188I TCNGA 1 cut(s) 362
Hpy188III TCNNGA 1 cut(s) 146
HpyCH4V TGCA 5 cut(s) 55, 88, 98, 280, 303
Hsp92II CATG 3 cut(s) 275, 317, 337
LpnPI CCDG 7 cut(s) 38, 48, 159, 218, 313, 331, 358
Lsp1109I GCAGC 3 cut(s) 82, 216, 271
MaeIII GTNAC 2 cut(s) 107, 186
MboII GAAGA 1 cut(s) 53
MluCI AATT 1 cut(s) 44
MlyI GAGTC 1 cut(s) 351
MnlI CCTC 1 cut(s) 232
MroXI GAANNNNTTC 1 cut(s) 45
MseI TTAA 1 cut(s) 267
MslI CAYNNNNRTG 1 cut(s) 318
MspR9I CCNGG 1 cut(s) 346
MvaI CCWGG 1 cut(s) 346
NdeI CATATG 1 cut(s) 250
NlaIII CATG 3 cut(s) 275, 317, 337
NlaIV GGNNCC 1 cut(s) 339
NmuCI GTSAC 1 cut(s) 107
NspI RCATGY 1 cut(s) 317
PdmI GAANNNNTTC 1 cut(s) 45
PfeI GAWTC 1 cut(s) 28
PkrI GCNGC 3 cut(s) 97, 231, 286
PleI GAGTC 1 cut(s) 351
PpsI GAGTC 1 cut(s) 351
PpuMI RGGWCCY 1 cut(s) 22
Psp5II RGGWCCY 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 344
PspGI CCWGG 1 cut(s) 344
PspN4I GGNNCC 1 cut(s) 339
PspPI GGNCC 1 cut(s) 22
PspPPI RGGWCCY 1 cut(s) 22
PstI CTGCAG 1 cut(s) 305
RsaI GTAC 2 cut(s) 262, 332
RsaNI GTAC 2 cut(s) 261, 331
RseI CAYNNNNRTG 1 cut(s) 318
SaqAI TTAA 1 cut(s) 267
SatI GCNGC 3 cut(s) 96, 230, 285
Sau96I GGNCC 1 cut(s) 22
SchI GAGTC 1 cut(s) 351
ScrFI CCNGG 1 cut(s) 346
SetI ASST 7 cut(s) 27, 93, 104, 120, 141, 231, 286
SfcI CTRYAG 1 cut(s) 301
SinI GGWCC 1 cut(s) 22
SmiMI CAYNNNNRTG 1 cut(s) 318
Sse9I AATT 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 344
StyI CCWWGG 1 cut(s) 205
TaqII GACCGA 1 cut(s) 95
TasI AATT 1 cut(s) 44
TatI WGTACW 1 cut(s) 330
TfiI GAWTC 1 cut(s) 28
Tru1I TTAA 1 cut(s) 267
Tru9I TTAA 1 cut(s) 267
TseFI GTSAC 1 cut(s) 107
TseI GCWGC 3 cut(s) 95, 229, 284
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 54, 288
TspGWI ACGGA 1 cut(s) 174
VpaK11BI GGWCC 1 cut(s) 22
XapI RAATTY 1 cut(s) 44
XceI RCATGY 1 cut(s) 317
XmnI GAANNNNTTC 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.