Rmu_co8522085.1_g000001

ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8522085.1
Physical Location & Seq
Reverse (-)
526 .. 1149
624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8522085.1_g000001.1.cds

Sequence Viewer

Length: 624 bp
ctgttctctttaaccccaaaggttgatgagatagattctgggactacaacaacattagaaagtcctagagctgcacaggaggaagaatttgaaaggctttctgaaggtaacacgcatccaggaagtgatcgatctgattgtgaaattgacatggggcgtatggctcgaaacaatcaacaaatgaaacacttcgctacagtacaagcaaagatgaatcccggtcatgatgttttaatgaattctgacgttctttttagagggacaatggataaaactaggcaatatgagatatatagagaggcattgcaaaatactaggaacactatcacaatagttgctgttttgactgactcagttacttttactgctggcataaacccacctggtggtgtctaccaggagggatggtttaaaggacagtcaatatacagttggcagaacaacagctttaaggtcttcacaataagcaacacagcggcattgttcatatctatgtgcattgtcattgtgttggtgagcatcattcccttccggcgaaaatcactgatgacactatttgtggttgctcacaaagtcttgttggtggcagtgtcactcatgttgctcacaaagtcttgttggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

207

Amino Acids

23.26

Weight (kDa)

7.08

Isoelectric Point (pI)

30.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 386
AccI GTMKAC 1 cut(s) 393
AciI CCGC 1 cut(s) 476
AcsI RAATTY 2 cut(s) 86, 238
AcuI CTGAAG 1 cut(s) 123
AdeI CACNNNGTG 1 cut(s) 386
AfaI GTAC 1 cut(s) 201
AfiI CCNNNNNNNGG 1 cut(s) 386
AgsI TTSAA 1 cut(s) 92
AjnI CCWGG 3 cut(s) 118, 382, 396
AluBI AGCT 2 cut(s) 71, 447
AluI AGCT 2 cut(s) 71, 447
ApeKI GCWGC 1 cut(s) 71
ApoI RAATTY 2 cut(s) 86, 238
Asp700I GAANNNNTTC 1 cut(s) 188
AsuC2I CCSGG 1 cut(s) 219
AsuHPI GGTGA 1 cut(s) 526
BbsI GAAGAC 1 cut(s) 448
BbvI GCAGC 1 cut(s) 58
BccI CCATC 1 cut(s) 399
BciT130I CCWGG 3 cut(s) 120, 384, 398
BcnI CCSGG 1 cut(s) 219
BfaI CTAG 3 cut(s) 66, 276, 315
BfmI CTRYAG 1 cut(s) 195
BisI GCNGC 2 cut(s) 72, 477
BlsI GCNGC 2 cut(s) 73, 478
Bme1390I CCNGG 4 cut(s) 120, 219, 384, 398
BmrFI CCNGG 4 cut(s) 120, 219, 384, 398
BmsI GCATC 2 cut(s) 124, 528
BpiI GAAGAC 1 cut(s) 448
BpuMI CCSGG 1 cut(s) 219
Bsa29I ATCGAT 1 cut(s) 130
BsaXI ACNNNNNCTCC 2 cut(s) 392, 422
Bsc4I CCNNNNNNNGG 1 cut(s) 386
Bse3DI GCAATG 1 cut(s) 302
BseBI CCWGG 3 cut(s) 120, 384, 398
BseCI ATCGAT 1 cut(s) 130
BseGI GGATG 2 cut(s) 115, 410
BseLI CCNNNNNNNGG 1 cut(s) 386
BseMI GCAATG 1 cut(s) 302
BseMII CTCAG 1 cut(s) 366
BseXI GCAGC 1 cut(s) 58
BsgI GTGCAG 1 cut(s) 57
BshVI ATCGAT 1 cut(s) 130
BsiSI CCGG 2 cut(s) 219, 532
BslFI GGGAC 2 cut(s) 55, 274
BslI CCNNNNNNNGG 1 cut(s) 386
BsmFI GGGAC 2 cut(s) 55, 274
Bsp143I GATC 2 cut(s) 127, 131
BspACI CCGC 1 cut(s) 476
BspCNI CTCAG 1 cut(s) 365
BspDI ATCGAT 1 cut(s) 130
BspHI TCATGA 1 cut(s) 223
BsrDI GCAATG 1 cut(s) 302
BssMI GATC 2 cut(s) 127, 131
Bst2UI CCWGG 3 cut(s) 120, 384, 398
Bst4CI ACNGT 3 cut(s) 199, 420, 431
BstC8I GCNNGC 1 cut(s) 370
BstDEI CTNAG 1 cut(s) 352
BstF5I GGATG 2 cut(s) 115, 410
BstKTI GATC 2 cut(s) 130, 134
BstMBI GATC 2 cut(s) 127, 131
BstNI CCWGG 3 cut(s) 120, 384, 398
BstSCI CCNGG 4 cut(s) 118, 217, 382, 396
BstSFI CTRYAG 1 cut(s) 195
BstV1I GCAGC 1 cut(s) 58
BstV2I GAAGAC 1 cut(s) 448
Bsu15I ATCGAT 1 cut(s) 130
BsuTUI ATCGAT 1 cut(s) 130
BtsCI GGATG 2 cut(s) 115, 410
BtsI GCAGTG 1 cut(s) 594
BtsIMutI CAGTG 2 cut(s) 542, 594
Cac8I GCNNGC 1 cut(s) 370
CciI TCATGA 1 cut(s) 223
ClaI ATCGAT 1 cut(s) 130
CsiI ACCWGGT 1 cut(s) 382
Csp6I GTAC 1 cut(s) 200
CviAII CATG 3 cut(s) 151, 224, 598
CviJI RGCY 4 cut(s) 71, 97, 164, 447
CviKI_1 RGCY 4 cut(s) 71, 97, 164, 447
CviQI GTAC 1 cut(s) 200
DdeI CTNAG 1 cut(s) 352
DpnI GATC 2 cut(s) 129, 133
DpnII GATC 2 cut(s) 127, 131
DraI TTTAAA 1 cut(s) 412
DraIII CACNNNGTG 1 cut(s) 386
Eco57I CTGAAG 1 cut(s) 123
EcoRI GAATTC 1 cut(s) 238
EcoRII CCWGG 3 cut(s) 118, 382, 396
FaeI CATG 3 cut(s) 154, 227, 601
FaqI GGGAC 2 cut(s) 55, 274
FatI CATG 3 cut(s) 150, 223, 597
FblI GTMKAC 1 cut(s) 393
Fnu4HI GCNGC 2 cut(s) 72, 477
FokI GGATG 2 cut(s) 102, 417
Fsp4HI GCNGC 2 cut(s) 72, 477
FspBI CTAG 3 cut(s) 66, 276, 315
GluI GCNGC 2 cut(s) 72, 477
HapII CCGG 2 cut(s) 219, 532
Hin1II CATG 3 cut(s) 154, 227, 601
HinfI GANTC 3 cut(s) 35, 214, 350
HpaII CCGG 2 cut(s) 219, 532
HphI GGTGA 1 cut(s) 526
Hpy166II GTNNAC 1 cut(s) 394
Hpy188I TCNGA 3 cut(s) 103, 136, 244
Hpy188III TCNNGA 1 cut(s) 224
Hpy8I GTNNAC 1 cut(s) 394
HpyAV CCTTC 2 cut(s) 98, 538
HpyCH4III ACNGT 3 cut(s) 199, 420, 431
HpyCH4IV ACGT 1 cut(s) 246
HpyCH4V TGCA 3 cut(s) 74, 307, 498
HpyF3I CTNAG 1 cut(s) 352
HpySE526I ACGT 1 cut(s) 246
Hsp92II CATG 3 cut(s) 154, 227, 601
Kzo9I GATC 2 cut(s) 127, 131
Lsp1109I GCAGC 1 cut(s) 58
LweI GCATC 2 cut(s) 124, 528
MabI ACCWGGT 1 cut(s) 382
MaeI CTAG 3 cut(s) 66, 276, 315
MaeII ACGT 1 cut(s) 246
MaeIII GTNAC 3 cut(s) 107, 355, 591
MalI GATC 2 cut(s) 129, 133
MboI GATC 2 cut(s) 127, 131
MboII GAAGA 2 cut(s) 95, 448
MluCI AATT 3 cut(s) 86, 144, 238
MlyI GAGTC 1 cut(s) 344
MnlI CCTC 4 cut(s) 73, 251, 292, 394
MroXI GAANNNNTTC 1 cut(s) 188
MseI TTAA 4 cut(s) 11, 233, 411, 450
MslI CAYNNNNRTG 1 cut(s) 491
MspA1I CMGCKG 1 cut(s) 476
MspI CCGG 2 cut(s) 219, 532
MspR9I CCNGG 4 cut(s) 120, 219, 384, 398
MvaI CCWGG 3 cut(s) 120, 384, 398
NciI CCSGG 1 cut(s) 219
NdeII GATC 2 cut(s) 127, 131
NlaIII CATG 3 cut(s) 154, 227, 601
NmuCI GTSAC 1 cut(s) 591
PagI TCATGA 1 cut(s) 223
PdmI GAANNNNTTC 1 cut(s) 188
PfeI GAWTC 2 cut(s) 35, 214
PflMI CCANNNNNTGG 1 cut(s) 386
PfoI TCCNGGA 1 cut(s) 118
PkrI GCNGC 2 cut(s) 73, 478
PleI GAGTC 1 cut(s) 344
PpsI GAGTC 1 cut(s) 344
Psp6I CCWGG 3 cut(s) 118, 382, 396
PspGI CCWGG 3 cut(s) 118, 382, 396
RsaI GTAC 1 cut(s) 201
RsaNI GTAC 1 cut(s) 200
RseI CAYNNNNRTG 1 cut(s) 491
SaqAI TTAA 4 cut(s) 11, 233, 411, 450
SatI GCNGC 2 cut(s) 72, 477
Sau3AI GATC 2 cut(s) 127, 131
SchI GAGTC 1 cut(s) 344
ScrFI CCNGG 4 cut(s) 120, 219, 384, 398
SetI ASST 7 cut(s) 24, 73, 109, 249, 385, 449, 456
SexAI ACCWGGT 1 cut(s) 382
SfaNI GCATC 2 cut(s) 124, 528
SfcI CTRYAG 1 cut(s) 195
SmiMI CAYNNNNRTG 1 cut(s) 491
Sse9I AATT 3 cut(s) 86, 144, 238
SsiI CCGC 1 cut(s) 476
SspMI CTAG 3 cut(s) 66, 276, 315
StyD4I CCNGG 4 cut(s) 118, 217, 382, 396
TaaI ACNGT 3 cut(s) 199, 420, 431
TaiI ACGT 1 cut(s) 249
TaqI TCGA 2 cut(s) 130, 166
TasI AATT 3 cut(s) 86, 144, 238
TatI WGTACW 1 cut(s) 199
TauI GCSGC 1 cut(s) 479
TfiI GAWTC 2 cut(s) 35, 214
Tru1I TTAA 4 cut(s) 11, 233, 411, 450
Tru9I TTAA 4 cut(s) 11, 233, 411, 450
TscAI CASTG 2 cut(s) 549, 594
TseFI GTSAC 1 cut(s) 591
TseI GCWGC 1 cut(s) 71
Tsp45I GTSAC 1 cut(s) 591
TspDTI ATGAA 4 cut(s) 197, 227, 251, 475
TspRI CASTG 2 cut(s) 549, 594
Van91I CCANNNNNTGG 1 cut(s) 386
XapI RAATTY 2 cut(s) 86, 238
XmiI GTMKAC 1 cut(s) 393
XmnI GAANNNNTTC 1 cut(s) 188
XspI CTAG 3 cut(s) 66, 276, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.