Rmu_sc0000545.1_g000026

ankyrin repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000545.1
OG0001058
Physical Location & Seq
Forward (+)
115549 .. 119619
4071 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000545.1_g000026.1.cds

Sequence Viewer

Length: 1011 bp
atgagagtcgagagggttgagagcctttcctcggcgaaccctagctccgctcccttggtgcggcttccagggaggactcagccgcctccacttactctacgtttgaggctgacatttgatcagctatttccttgtgtcaaggagaggcgaattacaggctgtttggaatggctcagtttatgtagggattggaagattttaaatggaggcacaggaatcagaatcttgttgtggtggaaggaattgtggctgctgtggctacgatgttcgtactcaagcactgaatctgggcaccttgttcttgggatttcatatcagggcgatacagtacccacgaactctatggaagatctggatttgggacccagagtcgatggcttggctgatcggatccttcttccagggaggctggtggctttgttgggtgcagacgaagctttgggtactttcactactggtataaatccccctggtggtgtctaccaggagggccagcttaaaggacagtcaacagttggcagaacaacagcttttatggtctttgcaatatgcaacacagcagcacttttcatatctatgtgcattgtcattgtcttggtcagcagcattcccttccggcgaaaaccactaatgaaactactggtggttgctcacaaagtaatgtgggtggcggtgtcactaatggccacagcttatgtcgcagccatgtggatgatcatgccacacggtgaaggtgtaaattggacccttgaagtagagatatctgtgtgtgcagggactatgggatctgtttttttattccttggtgtcacatggaccagacactggttgatgaagttcaagtggaggaagcagagaggtaaaaccacagaggaaagagcacataaacaagctgtacgagcacataaaagagcgcagaaaagaacagaggatacaccagaatacaactcatcattatccaccaactccattgcttggagtttcgaagaactagtatatcatacgtactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 Ank_4 Ank_5 PGG

Protein Analysis

336

Amino Acids

37.81

Weight (kDa)

9.46

Isoelectric Point (pI)

34.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 291
AccB7I CCANNNNNTGG 2 cut(s) 825, 975
AccBSI CCGCTC 1 cut(s) 50
AccI GTMKAC 1 cut(s) 480
AciI CCGC 4 cut(s) 48, 61, 83, 671
AclWI GGATC 3 cut(s) 385, 398, 793
AcoI YGGCCR 1 cut(s) 684
AdeI CACNNNGTG 1 cut(s) 728
AfaI GTAC 5 cut(s) 272, 330, 445, 897, 1007
AfiI CCNNNNNNNGG 5 cut(s) 31, 60, 473, 825, 975
AgsI TTSAA 2 cut(s) 752, 841
AhdI GACNNNNNGTC 1 cut(s) 368
AhlI ACTAGT 1 cut(s) 991
AjnI CCWGG 4 cut(s) 67, 400, 469, 483
AloI GAACNNNNNNTCC 2 cut(s) 29, 61
AluBI AGCT 7 cut(s) 45, 124, 437, 496, 530, 692, 893
AluI AGCT 7 cut(s) 45, 124, 437, 496, 530, 692, 893
Alw21I GWGCWC 2 cut(s) 883, 904
AlwI GGATC 3 cut(s) 385, 398, 793
AlwNI CAGNNNCTG 1 cut(s) 825
AoxI GGCC 2 cut(s) 490, 684
ApeKI GCWGC 4 cut(s) 250, 560, 603, 701
AspLEI GCGC 1 cut(s) 916
AspS9I GGNCC 4 cut(s) 362, 490, 744, 816
AsuHPI GGTGA 1 cut(s) 740
AsuII TTCGAA 1 cut(s) 984
AvaII GGWCC 3 cut(s) 362, 744, 816
BaeGI GKGCMC 1 cut(s) 294
BalI TGGCCA 1 cut(s) 686
BamHI GGATCC 1 cut(s) 390
BanI GGYRCC 1 cut(s) 291
Bbv12I GWGCWC 2 cut(s) 883, 904
BbvI GCAGC 4 cut(s) 237, 572, 615, 713
BccI CCATC 1 cut(s) 368
BciT130I CCWGG 4 cut(s) 69, 402, 471, 485
BciVI GTATCC 1 cut(s) 925
BclI TGATCA 2 cut(s) 118, 714
BcuI ACTAGT 1 cut(s) 991
BfaI CTAG 2 cut(s) 42, 992
BfuI GTATCC 1 cut(s) 925
BglII AGATCT 1 cut(s) 349
BisI GCNGC 6 cut(s) 62, 83, 251, 561, 604, 702
BlsI GCNGC 6 cut(s) 63, 84, 252, 562, 605, 703
Bme1390I CCNGG 4 cut(s) 69, 402, 471, 485
Bme18I GGWCC 3 cut(s) 362, 744, 816
BmeRI GACNNNNNGTC 1 cut(s) 368
BmgT120I GGNCC 4 cut(s) 362, 490, 744, 816
BmiI GGNNCC 5 cut(s) 293, 363, 364, 392, 746
BmrFI CCNGG 4 cut(s) 69, 402, 471, 485
Bpu14I TTCGAA 1 cut(s) 984
BpuEI CTTGAG 1 cut(s) 259
BsaAI YACGTR 1 cut(s) 1005
BsaJI CCNNGG 6 cut(s) 30, 54, 68, 401, 469, 802
BsaXI ACNNNNNCTCC 2 cut(s) 29, 59
Bsc4I CCNNNNNNNGG 5 cut(s) 31, 60, 473, 825, 975
Bse1I ACTGG 3 cut(s) 460, 645, 830
Bse3DI GCAATG 1 cut(s) 969
BseBI CCWGG 4 cut(s) 69, 402, 471, 485
BseDI CCNNGG 6 cut(s) 30, 54, 68, 401, 469, 802
BseGI GGATG 1 cut(s) 717
BseLI CCNNNNNNNGG 5 cut(s) 31, 60, 473, 825, 975
BseMI GCAATG 1 cut(s) 969
BseMII CTCAG 2 cut(s) 92, 187
BseNI ACTGG 3 cut(s) 460, 645, 830
BseSI GKGCMC 1 cut(s) 294
BseXI GCAGC 4 cut(s) 237, 572, 615, 713
BsgI GTGCAG 2 cut(s) 447, 792
BshFI GGCC 2 cut(s) 492, 686
BshNI GGYRCC 1 cut(s) 291
BsiHKAI GWGCWC 2 cut(s) 883, 904
BsiSI CCGG 1 cut(s) 616
BslFI GGGAC 2 cut(s) 375, 790
BslI CCNNNNNNNGG 5 cut(s) 31, 60, 473, 825, 975
BsmFI GGGAC 2 cut(s) 375, 790
BsmI GAATGC 1 cut(s) 606
BsnI GGCC 2 cut(s) 492, 686
Bsp119I TTCGAA 1 cut(s) 984
Bsp1286I GDGCHC 3 cut(s) 294, 883, 904
Bsp143I GATC 6 cut(s) 118, 349, 385, 390, 714, 785
BspACI CCGC 4 cut(s) 48, 61, 83, 671
BspANI GGCC 2 cut(s) 492, 686
BspCNI CTCAG 2 cut(s) 91, 186
BspLI GGNNCC 5 cut(s) 293, 363, 364, 392, 746
BspPI GGATC 3 cut(s) 385, 398, 793
BspT104I TTCGAA 1 cut(s) 984
BspT107I GGYRCC 1 cut(s) 291
BsrBI CCGCTC 1 cut(s) 50
BsrDI GCAATG 1 cut(s) 969
BsrI ACTGG 3 cut(s) 460, 645, 830
BssECI CCNNGG 6 cut(s) 30, 54, 68, 401, 469, 802
BssMI GATC 6 cut(s) 118, 349, 385, 390, 714, 785
BssT1I CCWWGG 2 cut(s) 54, 802
Bst2UI CCWGG 4 cut(s) 69, 402, 471, 485
Bst4CI ACNGT 4 cut(s) 328, 507, 514, 728
BstBAI YACGTR 1 cut(s) 1005
BstBI TTCGAA 1 cut(s) 984
BstC8I GCNNGC 1 cut(s) 494
BstDEI CTNAG 2 cut(s) 78, 173
BstF5I GGATG 1 cut(s) 717
BstHHI GCGC 1 cut(s) 916
BstKTI GATC 6 cut(s) 121, 352, 388, 393, 717, 788
BstMBI GATC 6 cut(s) 118, 349, 385, 390, 714, 785
BstMWI GCNNNNNNNGC 4 cut(s) 256, 434, 698, 899
BstNI CCWGG 4 cut(s) 69, 402, 471, 485
BstSCI CCNGG 4 cut(s) 67, 400, 469, 483
BstSLI GKGCMC 1 cut(s) 294
BstSNI TACGTA 1 cut(s) 1005
BstV1I GCAGC 4 cut(s) 237, 572, 615, 713
BstX2I RGATCY 3 cut(s) 349, 390, 785
BstYI RGATCY 3 cut(s) 349, 390, 785
BsuI GTATCC 1 cut(s) 925
BsuRI GGCC 2 cut(s) 492, 686
BtsCI GGATG 1 cut(s) 717
BtsIMutI CAGTG 2 cut(s) 279, 823
Cac8I GCNNGC 1 cut(s) 494
CaiI CAGNNNCTG 1 cut(s) 825
CfoI GCGC 1 cut(s) 916
Cfr13I GGNCC 4 cut(s) 362, 490, 744, 816
Csp6I GTAC 5 cut(s) 271, 329, 444, 896, 1006
CviAII CATG 3 cut(s) 706, 718, 813
CviQI GTAC 5 cut(s) 271, 329, 444, 896, 1006
DdeI CTNAG 2 cut(s) 78, 173
DpnI GATC 6 cut(s) 120, 351, 387, 392, 716, 787
DpnII GATC 6 cut(s) 118, 349, 385, 390, 714, 785
DraI TTTAAA 1 cut(s) 201
DraIII CACNNNGTG 1 cut(s) 728
DriI GACNNNNNGTC 1 cut(s) 368
EaeI YGGCCR 1 cut(s) 684
Eam1105I GACNNNNNGTC 1 cut(s) 368
Eco105I TACGTA 1 cut(s) 1005
Eco130I CCWWGG 2 cut(s) 54, 802
Eco32I GATATC 1 cut(s) 762
Eco47I GGWCC 3 cut(s) 362, 744, 816
EcoO109I RGGNCCY 1 cut(s) 362
EcoRII CCWGG 4 cut(s) 67, 400, 469, 483
EcoRV GATATC 1 cut(s) 762
EcoT14I CCWWGG 2 cut(s) 54, 802
ErhI CCWWGG 2 cut(s) 54, 802
FaeI CATG 3 cut(s) 709, 721, 816
FaqI GGGAC 2 cut(s) 375, 790
FatI CATG 3 cut(s) 705, 717, 812
FbaI TGATCA 2 cut(s) 118, 714
FblI GTMKAC 1 cut(s) 480
Fnu4HI GCNGC 6 cut(s) 62, 83, 251, 561, 604, 702
FokI GGATG 1 cut(s) 724
Fsp4HI GCNGC 6 cut(s) 62, 83, 251, 561, 604, 702
FspBI CTAG 2 cut(s) 42, 992
GlaI GCGC 1 cut(s) 915
GluI GCNGC 6 cut(s) 62, 83, 251, 561, 604, 702
HaeIII GGCC 2 cut(s) 492, 686
HapII CCGG 1 cut(s) 616
HhaI GCGC 1 cut(s) 916
Hin1II CATG 3 cut(s) 709, 721, 816
Hin6I GCGC 1 cut(s) 914
HinP1I GCGC 1 cut(s) 914
HincII GTYRAC 1 cut(s) 510
HindII GTYRAC 1 cut(s) 510
HindIII AAGCTT 1 cut(s) 435
HinfI GANTC 6 cut(s) 6, 76, 216, 222, 284, 369
HpaII CCGG 1 cut(s) 616
HphI GGTGA 1 cut(s) 740
Hpy166II GTNNAC 2 cut(s) 481, 510
Hpy188I TCNGA 2 cut(s) 221, 390
Hpy188III TCNNGA 2 cut(s) 10, 353
Hpy8I GTNNAC 2 cut(s) 481, 510
HpyAV CCTTC 4 cut(s) 232, 404, 622, 725
HpyCH4III ACNGT 4 cut(s) 328, 507, 514, 728
HpyCH4IV ACGT 2 cut(s) 100, 1004
HpyCH4V TGCA 5 cut(s) 428, 545, 552, 582, 773
HpyF10VI GCNNNNNNNGC 4 cut(s) 256, 434, 698, 899
HpyF3I CTNAG 2 cut(s) 78, 173
HpySE526I ACGT 2 cut(s) 100, 1004
Hsp92II CATG 3 cut(s) 709, 721, 816
HspAI GCGC 1 cut(s) 914
KflI GGGWCCC 1 cut(s) 362
Ksp22I TGATCA 2 cut(s) 118, 714
Kzo9I GATC 6 cut(s) 118, 349, 385, 390, 714, 785
LmnI GCTCC 2 cut(s) 50, 55
Lsp1109I GCAGC 4 cut(s) 237, 572, 615, 713
MaeI CTAG 2 cut(s) 42, 992
MaeII ACGT 2 cut(s) 100, 1004
MaeIII GTNAC 2 cut(s) 675, 808
MalI GATC 6 cut(s) 120, 351, 387, 392, 716, 787
MbiI CCGCTC 1 cut(s) 50
MboI GATC 6 cut(s) 118, 349, 385, 390, 714, 785
MboII GAAGA 4 cut(s) 205, 359, 389, 998
MflI RGATCY 3 cut(s) 349, 390, 785
MhlI GDGCHC 3 cut(s) 294, 883, 904
MlsI TGGCCA 1 cut(s) 686
MluCI AATT 3 cut(s) 150, 242, 739
MluNI TGGCCA 1 cut(s) 686
MlyI GAGTC 3 cut(s) 15, 70, 378
Mox20I TGGCCA 1 cut(s) 686
MscI TGGCCA 1 cut(s) 686
MseI TTAA 2 cut(s) 200, 498
MslI CAYNNNNRTG 2 cut(s) 575, 710
Msp20I TGGCCA 1 cut(s) 686
MspI CCGG 1 cut(s) 616
MspR9I CCNGG 4 cut(s) 69, 402, 471, 485
Mva1269I GAATGC 1 cut(s) 606
MvaI CCWGG 4 cut(s) 69, 402, 471, 485
MwoI GCNNNNNNNGC 4 cut(s) 256, 434, 698, 899
NdeII GATC 6 cut(s) 118, 349, 385, 390, 714, 785
NlaIII CATG 3 cut(s) 709, 721, 816
NlaIV GGNNCC 5 cut(s) 293, 363, 364, 392, 746
NmeAIII GCCGAG 1 cut(s) 11
NmuCI GTSAC 2 cut(s) 675, 808
NspV TTCGAA 1 cut(s) 984
PctI GAATGC 1 cut(s) 606
PfeI GAWTC 3 cut(s) 216, 222, 284
PflMI CCANNNNNTGG 2 cut(s) 825, 975
PkrI GCNGC 6 cut(s) 63, 84, 252, 562, 605, 703
PleI GAGTC 3 cut(s) 14, 70, 377
PpsI GAGTC 3 cut(s) 14, 70, 377
Ppu21I YACGTR 1 cut(s) 1005
PpuMI RGGWCCY 1 cut(s) 362
Psp5II RGGWCCY 1 cut(s) 362
Psp6I CCWGG 4 cut(s) 67, 400, 469, 483
PspGI CCWGG 4 cut(s) 67, 400, 469, 483
PspN4I GGNNCC 5 cut(s) 293, 363, 364, 392, 746
PspPI GGNCC 4 cut(s) 362, 490, 744, 816
PspPPI RGGWCCY 1 cut(s) 362
PsrI GAACNNNNNNTAC 2 cut(s) 916, 948
PstNI CAGNNNCTG 1 cut(s) 825
PsuI RGATCY 3 cut(s) 349, 390, 785
RsaI GTAC 5 cut(s) 272, 330, 445, 897, 1007
RsaNI GTAC 5 cut(s) 271, 329, 444, 896, 1006
RseI CAYNNNNRTG 2 cut(s) 575, 710
SaqAI TTAA 2 cut(s) 200, 498
SatI GCNGC 6 cut(s) 62, 83, 251, 561, 604, 702
Sau3AI GATC 6 cut(s) 118, 349, 385, 390, 714, 785
Sau96I GGNCC 4 cut(s) 362, 490, 744, 816
SchI GAGTC 3 cut(s) 15, 70, 378
ScrFI CCNGG 4 cut(s) 69, 402, 471, 485
SduI GDGCHC 3 cut(s) 294, 883, 904
SfuI TTCGAA 1 cut(s) 984
SinI GGWCC 3 cut(s) 362, 744, 816
SmiMI CAYNNNNRTG 2 cut(s) 575, 710
SmlI CTYRAG 1 cut(s) 274
SmoI CTYRAG 1 cut(s) 274
SnaBI TACGTA 1 cut(s) 1005
SpeI ACTAGT 1 cut(s) 991
Sse9I AATT 3 cut(s) 150, 242, 739
SsiI CCGC 4 cut(s) 48, 61, 83, 671
SspMI CTAG 2 cut(s) 42, 992
StyD4I CCNGG 4 cut(s) 67, 400, 469, 483
StyI CCWWGG 2 cut(s) 54, 802
TaaI ACNGT 4 cut(s) 328, 507, 514, 728
TaiI ACGT 2 cut(s) 103, 1007
TaqI TCGA 3 cut(s) 9, 372, 984
TasI AATT 3 cut(s) 150, 242, 739
TauI GCSGC 2 cut(s) 64, 85
TfiI GAWTC 3 cut(s) 216, 222, 284
Tru1I TTAA 2 cut(s) 200, 498
Tru9I TTAA 2 cut(s) 200, 498
TscAI CASTG 2 cut(s) 286, 830
TseFI GTSAC 2 cut(s) 675, 808
TseI GCWGC 4 cut(s) 250, 560, 603, 701
Tsp45I GTSAC 2 cut(s) 675, 808
TspDTI ATGAA 4 cut(s) 300, 559, 647, 848
TspRI CASTG 2 cut(s) 286, 830
Van91I CCANNNNNTGG 2 cut(s) 825, 975
VpaK11BI GGWCC 3 cut(s) 362, 744, 816
XcmI CCANNNNNNNNNTGG 1 cut(s) 340
XmiI GTMKAC 1 cut(s) 480
XspI CTAG 2 cut(s) 42, 992
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.