Rh2BG420900

ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
59211045 .. 59211593
549 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG420900.1

Sequence Viewer

Length: 549 bp
ATGATGTCAAAATTTCAGTTATCAGAGTACATCATCAGAAATACTGCGGTAGATGTCAATTTTAAGAACCAAAGAGCTCAAATAGCGTTGGACATCCTAAACCAGCGAAGAATATCGGATCTTAGTAACATGTTGATGAGTCTCGGTGGCAGGACCAGTATTGAGCTGTTCCATTTAACCCTAAAGGTTGATGAGATAGATTCTGAGACTACTGCAACAACATTAGAAAGTCCTAGAGCTGCACTTGAGCAAGACTTTGAAATGCTTTTTGAAGGTAATACGCATCCAGGAAGTGATCAATATGATTGTGAAATTGGTAGGGGGTGCATGGCTAGAAACTGTACGGGAGTTATTCCATTCATGATGGATTCAATCCTCAGAAACAATCAACCAATGGAAGACTTCACTACAGTACAAGCGAAGATGAATCCATGTCATCAAGTTGTGAAGAACTCTGATAATGTTTTTGGCTCAAGTTCTTCTAGAACAAGAATGAGCTCCCAAGTCTCAAATCCAAAGCAGCTTCCGAAGCCCAAGAGGAAAAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

182

Amino Acids

20.59

Weight (kDa)

7.68

Isoelectric Point (pI)

50.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 47
AclWI GGATC 1 cut(s) 126
AcsI RAATTY 1 cut(s) 11
AfaI GTAC 3 cut(s) 29, 343, 414
AflIII ACRYGT 1 cut(s) 129
AgsI TTSAA 3 cut(s) 260, 272, 372
AjnI CCWGG 1 cut(s) 286
AluBI AGCT 5 cut(s) 77, 166, 239, 498, 523
AluI AGCT 5 cut(s) 77, 166, 239, 498, 523
Alw21I GWGCWC 2 cut(s) 79, 500
Alw26I GTCTC 3 cut(s) 146, 200, 511
AlwI GGATC 1 cut(s) 126
ApeKI GCWGC 2 cut(s) 239, 520
ApoI RAATTY 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 153
AvaII GGWCC 1 cut(s) 153
BanII GRGCYC 2 cut(s) 79, 500
BbsI GAAGAC 1 cut(s) 405
Bbv12I GWGCWC 2 cut(s) 79, 500
BbvI GCAGC 2 cut(s) 226, 532
BccI CCATC 1 cut(s) 358
BciT130I CCWGG 1 cut(s) 288
BclI TGATCA 1 cut(s) 295
BcoDI GTCTC 3 cut(s) 146, 200, 511
BfaI CTAG 3 cut(s) 234, 333, 483
BfmI CTRYAG 1 cut(s) 408
BisI GCNGC 2 cut(s) 240, 521
BlsI GCNGC 2 cut(s) 241, 522
Bme1390I CCNGG 1 cut(s) 288
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 288
BmsI GCATC 1 cut(s) 292
BpiI GAAGAC 1 cut(s) 405
BpuEI CTTGAG 2 cut(s) 266, 457
Bse1I ACTGG 1 cut(s) 156
BseBI CCWGG 1 cut(s) 288
BseGI GGATG 2 cut(s) 93, 283
BseMII CTCAG 2 cut(s) 195, 391
BseNI ACTGG 1 cut(s) 156
BseXI GCAGC 2 cut(s) 226, 532
BsgI GTGCAG 1 cut(s) 225
BsiHKAI GWGCWC 2 cut(s) 79, 500
BsmAI GTCTC 3 cut(s) 146, 200, 511
Bsp1286I GDGCHC 2 cut(s) 79, 500
Bsp143I GATC 2 cut(s) 118, 295
BspACI CCGC 1 cut(s) 47
BspCNI CTCAG 2 cut(s) 196, 390
BspHI TCATGA 1 cut(s) 360
BspPI GGATC 1 cut(s) 126
BsrI ACTGG 1 cut(s) 156
BssMI GATC 2 cut(s) 118, 295
Bst2UI CCWGG 1 cut(s) 288
Bst4CI ACNGT 2 cut(s) 341, 412
BstDEI CTNAG 3 cut(s) 122, 204, 377
BstF5I GGATG 2 cut(s) 93, 283
BstKTI GATC 2 cut(s) 121, 298
BstMAI GTCTC 3 cut(s) 146, 200, 511
BstMBI GATC 2 cut(s) 118, 295
BstMWI GCNNNNNNNGC 2 cut(s) 83, 529
BstNI CCWGG 1 cut(s) 288
BstNSI RCATGY 1 cut(s) 133
BstSCI CCNGG 1 cut(s) 286
BstSFI CTRYAG 1 cut(s) 408
BstV1I GCAGC 2 cut(s) 226, 532
BstV2I GAAGAC 1 cut(s) 405
BstX2I RGATCY 1 cut(s) 118
BstYI RGATCY 1 cut(s) 118
BtsCI GGATG 2 cut(s) 93, 283
CciI TCATGA 1 cut(s) 360
Cfr13I GGNCC 1 cut(s) 153
Csp6I GTAC 3 cut(s) 28, 342, 413
CviAII CATG 4 cut(s) 130, 328, 361, 432
CviJI RGCY 8 cut(s) 77, 166, 239, 332, 471, 498, 523, 532
CviKI_1 RGCY 8 cut(s) 77, 166, 239, 332, 471, 498, 523, 532
CviQI GTAC 3 cut(s) 28, 342, 413
DdeI CTNAG 3 cut(s) 122, 204, 377
DpnI GATC 2 cut(s) 120, 297
DpnII GATC 2 cut(s) 118, 295
Ecl136II GAGCTC 2 cut(s) 77, 498
Eco24I GRGCYC 2 cut(s) 79, 500
Eco47I GGWCC 1 cut(s) 153
Eco53kI GAGCTC 2 cut(s) 77, 498
EcoICRI GAGCTC 2 cut(s) 77, 498
EcoRII CCWGG 1 cut(s) 286
EcoT38I GRGCYC 2 cut(s) 79, 500
FaeI CATG 4 cut(s) 133, 331, 364, 435
FaiI YATR 5 cut(s) 131, 303, 329, 362, 433
FatI CATG 4 cut(s) 129, 327, 360, 431
FbaI TGATCA 1 cut(s) 295
Fnu4HI GCNGC 2 cut(s) 240, 521
FokI GGATG 2 cut(s) 80, 270
FriOI GRGCYC 2 cut(s) 79, 500
Fsp4HI GCNGC 2 cut(s) 240, 521
FspBI CTAG 3 cut(s) 234, 333, 483
GluI GCNGC 2 cut(s) 240, 521
Hin1II CATG 4 cut(s) 133, 331, 364, 435
HinfI GANTC 4 cut(s) 139, 200, 368, 427
Hpy188I TCNGA 7 cut(s) 25, 38, 118, 205, 380, 457, 528
Hpy188III TCNNGA 2 cut(s) 361, 483
HpyAV CCTTC 1 cut(s) 266
HpyCH4III ACNGT 2 cut(s) 341, 412
HpyCH4V TGCA 3 cut(s) 215, 242, 327
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 529
HpyF3I CTNAG 3 cut(s) 122, 204, 377
Hsp92II CATG 4 cut(s) 133, 331, 364, 435
Ksp22I TGATCA 1 cut(s) 295
Kzo9I GATC 2 cut(s) 118, 295
LmnI GCTCC 1 cut(s) 503
LpnPI CCDG 5 cut(s) 116, 136, 169, 273, 300
Lsp1109I GCAGC 2 cut(s) 226, 532
LweI GCATC 1 cut(s) 292
MaeI CTAG 3 cut(s) 234, 333, 483
MaeIII GTNAC 1 cut(s) 125
MalI GATC 2 cut(s) 120, 297
MboI GATC 2 cut(s) 118, 295
MboII GAAGA 5 cut(s) 120, 410, 433, 460, 471
MflI RGATCY 1 cut(s) 118
MhlI GDGCHC 2 cut(s) 79, 500
MluCI AATT 3 cut(s) 11, 58, 312
MlyI GAGTC 1 cut(s) 148
MmeI TCCRAC 1 cut(s) 69
MnlI CCTC 2 cut(s) 386, 531
MseI TTAA 2 cut(s) 63, 176
MslI CAYNNNNRTG 1 cut(s) 134
MspR9I CCNGG 1 cut(s) 288
MvaI CCWGG 1 cut(s) 288
MwoI GCNNNNNNNGC 2 cut(s) 83, 529
NdeII GATC 2 cut(s) 118, 295
NlaIII CATG 4 cut(s) 133, 331, 364, 435
NspI RCATGY 1 cut(s) 133
PagI TCATGA 1 cut(s) 360
PciI ACATGT 1 cut(s) 129
PfeI GAWTC 3 cut(s) 200, 368, 427
PfoI TCCNGGA 1 cut(s) 286
PkrI GCNGC 2 cut(s) 241, 522
PleI GAGTC 1 cut(s) 147
PpsI GAGTC 1 cut(s) 147
PscI ACATGT 1 cut(s) 129
Psp124BI GAGCTC 2 cut(s) 79, 500
Psp6I CCWGG 1 cut(s) 286
PspGI CCWGG 1 cut(s) 286
PspPI GGNCC 1 cut(s) 153
PsuI RGATCY 1 cut(s) 118
RsaI GTAC 3 cut(s) 29, 343, 414
RsaNI GTAC 3 cut(s) 28, 342, 413
RseI CAYNNNNRTG 1 cut(s) 134
SacI GAGCTC 2 cut(s) 79, 500
SaqAI TTAA 2 cut(s) 63, 176
SatI GCNGC 2 cut(s) 240, 521
Sau3AI GATC 2 cut(s) 118, 295
Sau96I GGNCC 1 cut(s) 153
SchI GAGTC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 288
SduI GDGCHC 2 cut(s) 79, 500
SetI ASST 7 cut(s) 79, 168, 189, 241, 277, 500, 525
SfaNI GCATC 1 cut(s) 292
SfcI CTRYAG 1 cut(s) 408
SinI GGWCC 1 cut(s) 153
SmiMI CAYNNNNRTG 1 cut(s) 134
SmlI CTYRAG 2 cut(s) 245, 472
SmoI CTYRAG 2 cut(s) 245, 472
Sse9I AATT 3 cut(s) 11, 58, 312
SsiI CCGC 1 cut(s) 47
SspMI CTAG 3 cut(s) 234, 333, 483
SstI GAGCTC 2 cut(s) 79, 500
StyD4I CCNGG 1 cut(s) 286
TaaI ACNGT 2 cut(s) 341, 412
TasI AATT 3 cut(s) 11, 58, 312
TatI WGTACW 2 cut(s) 27, 412
TfiI GAWTC 3 cut(s) 200, 368, 427
Tru1I TTAA 2 cut(s) 63, 176
Tru9I TTAA 2 cut(s) 63, 176
TseI GCWGC 2 cut(s) 239, 520
TspDTI ATGAA 2 cut(s) 349, 440
VpaK11BI GGWCC 1 cut(s) 153
XapI RAATTY 1 cut(s) 11
XbaI TCTAGA 1 cut(s) 482
XceI RCATGY 1 cut(s) 133
XspI CTAG 3 cut(s) 234, 333, 483
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.