RchiOBHm_Chr1g0336331

Origin recognition complex subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
28011439 .. 28012872
1434 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGGAAATGGCAAAGGCTGGTGGGAAAGTTGTGGTGGAGAAGTCTAATACATGTGAAGAATGTGGTGCTAGTTTTAAGAAACCTGCGTATCTCAAGAAGCATATGCAAAGCCATTCTCCTGAGTCAATATTAAAATTTGACGAAGGAAGTTGTAAATTGGAGTTGAAGGAGATATCCAGAAGACATACATCTCGGAGTCGCTTAAAGATTGGTGAATCACAATCAATAAATGAAAAAGCTTCTATACTAATACATTGCATGGTTAGGTAA

Protein Analysis

89

Amino Acids

10.01

Weight (kDa)

9.33

Isoelectric Point (pI)

68.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-C2H2 PF00096 17 - 38 6.2e-06 Zinc finger, C2H2 type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 91
AcsI RAATTY 1 cut(s) 134
AflIII ACRYGT 1 cut(s) 50
AgsI TTSAA 1 cut(s) 166
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
ApoI RAATTY 1 cut(s) 134
AsuHPI GGTGA 1 cut(s) 224
BaeI ACNNNNGTAYC 2 cut(s) 71, 104
BbsI GAAGAC 1 cut(s) 187
BfaI CTAG 1 cut(s) 69
BfuAI ACCTGC 1 cut(s) 91
BpiI GAAGAC 1 cut(s) 187
BpuEI CTTGAG 1 cut(s) 77
Bse3DI GCAATG 1 cut(s) 253
BseMI GCAATG 1 cut(s) 253
BseMII CTCAG 1 cut(s) 111
BspCNI CTCAG 1 cut(s) 112
BspMI ACCTGC 1 cut(s) 91
BsrDI GCAATG 1 cut(s) 253
BstDEI CTNAG 1 cut(s) 120
BstNSI RCATGY 1 cut(s) 54
BstV2I GAAGAC 1 cut(s) 187
BveI ACCTGC 1 cut(s) 91
CviAII CATG 2 cut(s) 51, 259
CviJI RGCY 3 cut(s) 17, 111, 239
CviKI_1 RGCY 3 cut(s) 17, 111, 239
DdeI CTNAG 1 cut(s) 120
Eco32I GATATC 1 cut(s) 174
EcoRV GATATC 1 cut(s) 174
FaeI CATG 2 cut(s) 54, 262
FaiI YATR 6 cut(s) 52, 102, 104, 186, 245, 260
FatI CATG 2 cut(s) 50, 258
FauNDI CATATG 1 cut(s) 102
FspBI CTAG 1 cut(s) 69
Hin1II CATG 2 cut(s) 54, 262
HindIII AAGCTT 1 cut(s) 237
HinfI GANTC 3 cut(s) 122, 196, 215
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 1 cut(s) 195
Hpy188III TCNNGA 3 cut(s) 94, 119, 177
HpyAV CCTTC 2 cut(s) 137, 160
HpyCH4V TGCA 2 cut(s) 106, 258
HpyF3I CTNAG 1 cut(s) 120
Hsp92II CATG 2 cut(s) 54, 262
LpnPI CCDG 4 cut(s) 3, 96, 132, 190
MaeI CTAG 1 cut(s) 69
MboII GAAGA 2 cut(s) 68, 192
MluCI AATT 2 cut(s) 134, 155
MlyI GAGTC 2 cut(s) 131, 205
MseI TTAA 3 cut(s) 75, 131, 203
NdeI CATATG 1 cut(s) 102
NlaIII CATG 2 cut(s) 54, 262
NspI RCATGY 1 cut(s) 54
PciI ACATGT 1 cut(s) 50
PfeI GAWTC 1 cut(s) 215
PleI GAGTC 2 cut(s) 130, 204
PpsI GAGTC 2 cut(s) 130, 204
PscI ACATGT 1 cut(s) 50
SaqAI TTAA 3 cut(s) 75, 131, 203
SchI GAGTC 2 cut(s) 131, 205
SetI ASST 3 cut(s) 85, 241, 269
SgeI CNNG 8 cut(s) 30, 63, 81, 95, 106, 131, 189, 204
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 2 cut(s) 134, 155
SspI AATATT 1 cut(s) 129
SspMI CTAG 1 cut(s) 69
TasI AATT 2 cut(s) 134, 155
TfiI GAWTC 1 cut(s) 215
Tru1I TTAA 3 cut(s) 75, 131, 203
Tru9I TTAA 3 cut(s) 75, 131, 203
TspDTI ATGAA 1 cut(s) 246
XapI RAATTY 1 cut(s) 134
XceI RCATGY 1 cut(s) 54
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.