RchiOBHm_Chr1g0321371

Annexin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001318
Physical Location & Seq
Reverse (-)
8938337 .. 8939247
911 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55143

Sequence Viewer

Length: 273 bp
ATGGCAACATTCAACAAATACAGAGATGACCATGGCAACTCTATCAGCAAGAATTTCTTGGAGGATGGGGCTAATGATTTCCAGAAGGCATTACATACTGCCGTTCGATTCCTCAATGACCACAAGAAGTACCTTGAGAAGGTACTTCGCAAGGCGATCATAGGGACCGGGACCAATGAGGATGCTCTCACTCGTGTGATTGTTACAAGGGCAGAGAAGGACTTGAAGGACATCATGGAGGTTTACTACAAGAAGAACAGTGTTCCTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Annexin

Protein Analysis

90

Amino Acids

10.37

Weight (kDa)

9.19

Isoelectric Point (pI)

10.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Annexin PF00191 47 - 88 2.2e-09 Annexin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 52
AfaI GTAC 2 cut(s) 131, 144
AfiI CCNNNNNNNGG 1 cut(s) 139
AgsI TTSAA 2 cut(s) 13, 226
AleI CACNNNNGTG 1 cut(s) 194
ApoI RAATTY 1 cut(s) 52
AspS9I GGNCC 2 cut(s) 165, 171
AsuC2I CCSGG 1 cut(s) 169
AvaII GGWCC 2 cut(s) 165, 171
BauI CACGAG 1 cut(s) 192
BccI CCATC 1 cut(s) 59
BceAI ACGGC 1 cut(s) 86
BcnI CCSGG 1 cut(s) 169
Bme1390I CCNGG 1 cut(s) 169
Bme18I GGWCC 2 cut(s) 165, 171
BmgT120I GGNCC 2 cut(s) 165, 171
BmiI GGNNCC 2 cut(s) 166, 172
BmrFI CCNGG 1 cut(s) 169
BmsI GCATC 1 cut(s) 172
BpuEI CTTGAG 1 cut(s) 155
BpuMI CCSGG 1 cut(s) 169
BsaJI CCNNGG 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 139
BseDI CCNNGG 1 cut(s) 31
BseGI GGATG 2 cut(s) 70, 187
BseLI CCNNNNNNNGG 1 cut(s) 139
BsiSI CCGG 1 cut(s) 168
BslFI GGGAC 2 cut(s) 178, 184
BslI CCNNNNNNNGG 1 cut(s) 139
BsmFI GGGAC 2 cut(s) 178, 184
Bsp143I GATC 1 cut(s) 156
Bsp19I CCATGG 1 cut(s) 31
BspLI GGNNCC 2 cut(s) 166, 172
BssECI CCNNGG 1 cut(s) 31
BssMI GATC 1 cut(s) 156
BssSI CACGAG 1 cut(s) 192
BssT1I CCWWGG 1 cut(s) 31
Bst2BI CACGAG 1 cut(s) 192
Bst4CI ACNGT 1 cut(s) 260
BstDSI CCRYGG 1 cut(s) 31
BstENI CCTNNNNNAGG 1 cut(s) 137
BstF5I GGATG 2 cut(s) 70, 187
BstKTI GATC 1 cut(s) 159
BstMBI GATC 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 167
BtgI CCRYGG 1 cut(s) 31
BtsCI GGATG 2 cut(s) 70, 187
BtsIMutI CAGTG 1 cut(s) 265
Cfr13I GGNCC 2 cut(s) 165, 171
Csp6I GTAC 2 cut(s) 130, 143
CviAII CATG 2 cut(s) 32, 235
CviJI RGCY 1 cut(s) 71
CviKI_1 RGCY 1 cut(s) 71
CviQI GTAC 2 cut(s) 130, 143
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
Eco130I CCWWGG 1 cut(s) 31
Eco47I GGWCC 2 cut(s) 165, 171
EcoNI CCTNNNNNAGG 1 cut(s) 137
EcoT14I CCWWGG 1 cut(s) 31
ErhI CCWWGG 1 cut(s) 31
FaeI CATG 2 cut(s) 35, 238
FaiI YATR 4 cut(s) 33, 96, 161, 236
FalI AAGNNNNNCTT 2 cut(s) 41, 73
FaqI GGGAC 2 cut(s) 178, 184
FatI CATG 2 cut(s) 31, 234
FokI GGATG 2 cut(s) 77, 194
HapII CCGG 1 cut(s) 168
Hin1II CATG 2 cut(s) 35, 238
HinfI GANTC 1 cut(s) 108
HpaII CCGG 1 cut(s) 168
Hpy166II GTNNAC 1 cut(s) 244
Hpy188III TCNNGA 1 cut(s) 82
Hpy8I GTNNAC 1 cut(s) 244
HpyAV CCTTC 4 cut(s) 79, 133, 211, 220
HpyCH4III ACNGT 1 cut(s) 260
Hsp92II CATG 2 cut(s) 35, 238
Kzo9I GATC 1 cut(s) 156
LpnPI CCDG 2 cut(s) 95, 181
LweI GCATC 1 cut(s) 172
MaeIII GTNAC 1 cut(s) 202
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MboII GAAGA 1 cut(s) 265
MluCI AATT 1 cut(s) 52
MnlI CCTC 4 cut(s) 55, 122, 172, 232
MseI TTAA 1 cut(s) 271
MslI CAYNNNNRTG 1 cut(s) 194
MspI CCGG 1 cut(s) 168
MspR9I CCNGG 1 cut(s) 169
NciI CCSGG 1 cut(s) 169
NcoI CCATGG 1 cut(s) 31
NdeII GATC 1 cut(s) 156
NlaIII CATG 2 cut(s) 35, 238
NlaIV GGNNCC 2 cut(s) 166, 172
OliI CACNNNNGTG 1 cut(s) 194
PfeI GAWTC 1 cut(s) 108
PspN4I GGNNCC 2 cut(s) 166, 172
PspPI GGNCC 2 cut(s) 165, 171
RsaI GTAC 2 cut(s) 131, 144
RsaNI GTAC 2 cut(s) 130, 143
RseI CAYNNNNRTG 1 cut(s) 194
SaqAI TTAA 1 cut(s) 271
Sau3AI GATC 1 cut(s) 156
Sau96I GGNCC 2 cut(s) 165, 171
ScrFI CCNGG 1 cut(s) 169
SetI ASST 3 cut(s) 135, 144, 243
SfaNI GCATC 1 cut(s) 172
SinI GGWCC 2 cut(s) 165, 171
SmiMI CAYNNNNRTG 1 cut(s) 194
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 1 cut(s) 52
StyD4I CCNGG 1 cut(s) 167
StyI CCWWGG 1 cut(s) 31
TaaI ACNGT 1 cut(s) 260
TaqI TCGA 1 cut(s) 106
TasI AATT 1 cut(s) 52
TfiI GAWTC 1 cut(s) 108
Tru1I TTAA 1 cut(s) 271
Tru9I TTAA 1 cut(s) 271
TscAI CASTG 1 cut(s) 265
TspRI CASTG 1 cut(s) 265
VpaK11BI GGWCC 2 cut(s) 165, 171
XagI CCTNNNNNAGG 1 cut(s) 137
XapI RAATTY 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.