Rmu_sc0000087.1_g000013

Annexin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000087.1
OG0001318
Physical Location & Seq
Forward (+)
86123 .. 88376
2254 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000087.1_g000013.1.cds

Sequence Viewer

Length: 963 bp
atggcatcccttattactccagatcagttctctgctaaccaagatgccgaggctctccgaaaggcgtgtcaaggatgggggactaatgagaaggtcatcatctccatactgggtcatagaagtgcaactcaaagaaaagaaatcagggtcgcttatgaacaactttatcaagaagatcttctcaagcgccttgaatctgagctctctggtgattttgagagagcggtgtaccgttggacattggatccagctgatcgtgatgctgttttggctaatctggccattaagaaacccgagactgactacaatgtcatcatcgaaatctccagcgctcggtgtcctgaagagcttctagctgtaagaaaagcttaccagcttcgctacaggtgctccttggaagaagatctagctcaacacaccactggtgatatccgcaagcttttggttgctttggtgactgcttaccgctatgacggtaatgagatcaatgaaaagttggcgagctcagaagctaatattcttcacgatgctatcaaagggaagtgttttaatcatgaagaaattattaggatcctaagtacaaggagcaagacacagctcatggctacattcaacaaatacagagatgaccatggcagttctatcagcaaaaatttattggaggatgggactaatgatttcctgaaggcattgcatgtagccattcgatgcctcaatgaccccaagaagtactttgagaaggtagtaaccaaaatttcatgtgtactacgcaatgctatcatagggaccgggaccgatgaggatgctctcactcgtgtgattgttacaagggcagagagggacttgagggacatcatggtggtttactacaagaagaacagtgttcctcttgaacaggctgtggtccaagaaacttcaggggactacaaaaccttcctccttactctgttgggaaagaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Annexin

Protein Analysis

320

Amino Acids

36.35

Weight (kDa)

6.62

Isoelectric Point (pI)

32.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 308
AccBSI CCGCTC 1 cut(s) 224
AciI CCGC 3 cut(s) 224, 433, 466
AclWI GGATC 4 cut(s) 239, 252, 565, 578
AcoI YGGCCR 1 cut(s) 279
AcsI RAATTY 2 cut(s) 652, 753
AcuI CTGAAG 3 cut(s) 363, 704, 900
AfaI GTAC 4 cut(s) 230, 580, 731, 765
AfeI AGCGCT 1 cut(s) 331
AfiI CCNNNNNNNGG 1 cut(s) 333
AgsI TTSAA 3 cut(s) 194, 613, 893
AleI CACNNNNGTG 1 cut(s) 815
Alw21I GWGCWC 3 cut(s) 204, 392, 506
Alw26I GTCTC 1 cut(s) 290
AlwI GGATC 4 cut(s) 239, 252, 565, 578
Ama87I CYCGRG 1 cut(s) 293
Aor51HI AGCGCT 1 cut(s) 331
AoxI GGCC 1 cut(s) 279
ApoI RAATTY 2 cut(s) 652, 753
ArsI GACNNNNNNTTYG 2 cut(s) 52, 84
Asp700I GAANNNNTTC 2 cut(s) 177, 348
AspLEI GCGC 2 cut(s) 189, 332
AspS9I GGNCC 3 cut(s) 786, 792, 904
AsuC2I CCSGG 1 cut(s) 790
AsuHPI GGTGA 3 cut(s) 221, 437, 466
AvaI CYCGRG 1 cut(s) 293
AvaII GGWCC 3 cut(s) 786, 792, 904
BalI TGGCCA 1 cut(s) 281
BamHI GGATCC 2 cut(s) 244, 570
BanII GRGCYC 2 cut(s) 204, 506
BauI CACGAG 1 cut(s) 813
Bbv12I GWGCWC 3 cut(s) 204, 392, 506
BccI CCATC 2 cut(s) 69, 659
BcgI CGANNNNNNTGC 2 cut(s) 785, 819
BcnI CCSGG 1 cut(s) 790
BcoDI GTCTC 1 cut(s) 290
BfaI CTAG 2 cut(s) 353, 407
BfmI CTRYAG 1 cut(s) 382
BfoI RGCGCY 2 cut(s) 190, 333
BglII AGATCT 2 cut(s) 175, 403
BmcAI AGTACT 1 cut(s) 731
Bme1390I CCNGG 1 cut(s) 790
Bme18I GGWCC 3 cut(s) 786, 792, 904
BmeT110I CYCGRG 1 cut(s) 293
BmgT120I GGNCC 3 cut(s) 786, 792, 904
BmiI GGNNCC 4 cut(s) 246, 572, 787, 793
BmrFI CCNGG 1 cut(s) 790
BmrI ACTGGG 1 cut(s) 119
BmsI GCATC 6 cut(s) 14, 34, 250, 517, 698, 793
BmuI ACTGGG 1 cut(s) 119
BpmI CTGGAG 1 cut(s) 310
BpuEI CTTGAG 2 cut(s) 167, 865
BpuMI CCSGG 1 cut(s) 790
BsaJI CCNNGG 3 cut(s) 48, 393, 631
BsaXI ACNNNNNCTCC 2 cut(s) 374, 404
Bsc4I CCNNNNNNNGG 1 cut(s) 333
Bse1I ACTGG 2 cut(s) 114, 427
Bse3DI GCAATG 2 cut(s) 689, 778
BseDI CCNNGG 3 cut(s) 48, 393, 631
BseGI GGATG 4 cut(s) 5, 80, 670, 808
BseLI CCNNNNNNNGG 1 cut(s) 333
BseMI GCAATG 2 cut(s) 689, 778
BseMII CTCAG 2 cut(s) 189, 519
BseNI ACTGG 2 cut(s) 114, 427
BshFI GGCC 1 cut(s) 281
BsiHKAI GWGCWC 3 cut(s) 204, 392, 506
BsiHKCI CYCGRG 1 cut(s) 293
BsiSI CCGG 1 cut(s) 789
BslFI GGGAC 7 cut(s) 94, 682, 799, 805, 854, 863, 935
BslI CCNNNNNNNGG 1 cut(s) 333
BsmAI GTCTC 1 cut(s) 290
BsmFI GGGAC 7 cut(s) 94, 682, 799, 805, 854, 863, 935
BsnI GGCC 1 cut(s) 281
BsoBI CYCGRG 1 cut(s) 293
Bsp1286I GDGCHC 3 cut(s) 204, 392, 506
Bsp143I GATC 7 cut(s) 22, 175, 244, 253, 403, 483, 570
Bsp19I CCATGG 1 cut(s) 631
BspACI CCGC 3 cut(s) 224, 433, 466
BspANI GGCC 1 cut(s) 281
BspCNI CTCAG 2 cut(s) 190, 518
BspHI TCATGA 1 cut(s) 553
BspLI GGNNCC 4 cut(s) 246, 572, 787, 793
BspPI GGATC 4 cut(s) 239, 252, 565, 578
BspQI GCTCTTC 1 cut(s) 339
BsrBI CCGCTC 1 cut(s) 224
BsrDI GCAATG 2 cut(s) 689, 778
BsrI ACTGG 2 cut(s) 114, 427
BssECI CCNNGG 3 cut(s) 48, 393, 631
BssMI GATC 7 cut(s) 22, 175, 244, 253, 403, 483, 570
BssSI CACGAG 1 cut(s) 813
BssT1I CCWWGG 2 cut(s) 393, 631
Bst2BI CACGAG 1 cut(s) 813
Bst4CI ACNGT 3 cut(s) 233, 476, 881
Bst6I CTCTTC 1 cut(s) 339
BstC8I GCNNGC 2 cut(s) 437, 502
BstDEI CTNAG 3 cut(s) 198, 505, 575
BstDSI CCRYGG 1 cut(s) 631
BstF5I GGATG 4 cut(s) 5, 80, 670, 808
BstH2I RGCGCY 2 cut(s) 190, 333
BstHHI GCGC 2 cut(s) 189, 332
BstKTI GATC 7 cut(s) 25, 178, 247, 256, 406, 486, 573
BstMAI GTCTC 1 cut(s) 290
BstMBI GATC 7 cut(s) 22, 175, 244, 253, 403, 483, 570
BstMWI GCNNNNNNNGC 3 cut(s) 269, 278, 387
BstNSI RCATGY 1 cut(s) 698
BstSCI CCNGG 1 cut(s) 788
BstSFI CTRYAG 1 cut(s) 382
BstX2I RGATCY 4 cut(s) 175, 244, 403, 570
BstYI RGATCY 4 cut(s) 175, 244, 403, 570
BsuRI GGCC 1 cut(s) 281
BtgI CCRYGG 1 cut(s) 631
BtsCI GGATG 4 cut(s) 5, 80, 670, 808
BtsIMutI CAGTG 2 cut(s) 420, 886
Cac8I GCNNGC 2 cut(s) 437, 502
CciI TCATGA 1 cut(s) 553
CfoI GCGC 2 cut(s) 189, 332
Cfr13I GGNCC 3 cut(s) 786, 792, 904
Csp6I GTAC 4 cut(s) 229, 579, 730, 764
CviAII CATG 6 cut(s) 554, 601, 632, 695, 759, 856
CviQI GTAC 4 cut(s) 229, 579, 730, 764
DdeI CTNAG 3 cut(s) 198, 505, 575
DpnI GATC 7 cut(s) 24, 177, 246, 255, 405, 485, 572
DpnII GATC 7 cut(s) 22, 175, 244, 253, 403, 483, 570
DrdI GACNNNNNNGTC 1 cut(s) 308
DseDI GACNNNNNNGTC 1 cut(s) 308
EaeI YGGCCR 1 cut(s) 279
Eam1104I CTCTTC 1 cut(s) 339
EarI CTCTTC 1 cut(s) 339
Ecl136II GAGCTC 2 cut(s) 202, 504
Eco130I CCWWGG 2 cut(s) 393, 631
Eco24I GRGCYC 2 cut(s) 204, 506
Eco32I GATATC 1 cut(s) 430
Eco47I GGWCC 3 cut(s) 786, 792, 904
Eco47III AGCGCT 1 cut(s) 331
Eco53kI GAGCTC 2 cut(s) 202, 504
Eco57I CTGAAG 3 cut(s) 363, 704, 900
Eco88I CYCGRG 1 cut(s) 293
EcoICRI GAGCTC 2 cut(s) 202, 504
EcoRV GATATC 1 cut(s) 430
EcoT14I CCWWGG 2 cut(s) 393, 631
EcoT38I GRGCYC 2 cut(s) 204, 506
ErhI CCWWGG 2 cut(s) 393, 631
FaeI CATG 6 cut(s) 557, 604, 635, 698, 762, 859
FalI AAGNNNNNCTT 6 cut(s) 162, 194, 352, 384, 716, 748
FaqI GGGAC 7 cut(s) 94, 682, 799, 805, 854, 863, 935
FatI CATG 6 cut(s) 553, 600, 631, 694, 758, 855
FokI GGATG 3 cut(s) 87, 677, 815
FriOI GRGCYC 2 cut(s) 204, 506
FspBI CTAG 2 cut(s) 353, 407
GlaI GCGC 2 cut(s) 188, 331
GsuI CTGGAG 1 cut(s) 310
HaeII RGCGCY 2 cut(s) 190, 333
HaeIII GGCC 1 cut(s) 281
HapII CCGG 1 cut(s) 789
HhaI GCGC 2 cut(s) 189, 332
Hin1II CATG 6 cut(s) 557, 604, 635, 698, 762, 859
Hin6I GCGC 2 cut(s) 187, 330
HinP1I GCGC 2 cut(s) 187, 330
HindIII AAGCTT 2 cut(s) 366, 437
HinfI GANTC 1 cut(s) 194
HpaII CCGG 1 cut(s) 789
HphI GGTGA 3 cut(s) 221, 437, 466
Hpy166II GTNNAC 3 cut(s) 229, 764, 865
Hpy188I TCNGA 3 cut(s) 59, 199, 508
Hpy188III TCNNGA 8 cut(s) 20, 170, 257, 341, 524, 554, 682, 890
Hpy8I GTNNAC 3 cut(s) 229, 764, 865
HpyAV CCTTC 4 cut(s) 85, 679, 733, 943
HpyCH4III ACNGT 3 cut(s) 233, 476, 881
HpyCH4V TGCA 2 cut(s) 125, 694
HpyF10VI GCNNNNNNNGC 3 cut(s) 269, 278, 387
HpyF3I CTNAG 3 cut(s) 198, 505, 575
Hsp92II CATG 6 cut(s) 557, 604, 635, 698, 762, 859
HspAI GCGC 2 cut(s) 187, 330
Kzo9I GATC 7 cut(s) 22, 175, 244, 253, 403, 483, 570
LguI GCTCTTC 1 cut(s) 339
LmnI GCTCC 2 cut(s) 395, 585
LweI GCATC 6 cut(s) 14, 34, 250, 517, 698, 793
MaeI CTAG 2 cut(s) 353, 407
MaeIII GTNAC 3 cut(s) 454, 745, 823
MalI GATC 7 cut(s) 24, 177, 246, 255, 405, 485, 572
MbiI CCGCTC 1 cut(s) 224
MboI GATC 7 cut(s) 22, 175, 244, 253, 403, 483, 570
MboII GAAGA 8 cut(s) 170, 185, 356, 410, 413, 512, 569, 886
MflI RGATCY 4 cut(s) 175, 244, 403, 570
MhlI GDGCHC 3 cut(s) 204, 392, 506
MlsI TGGCCA 1 cut(s) 281
MluCI AATT 3 cut(s) 561, 652, 753
MluNI TGGCCA 1 cut(s) 281
MmeI TCCRAC 1 cut(s) 215
MnlI CCTC 8 cut(s) 43, 655, 722, 793, 831, 840, 897, 947
Mox20I TGGCCA 1 cut(s) 281
MroXI GAANNNNTTC 2 cut(s) 177, 348
MscI TGGCCA 1 cut(s) 281
MseI TTAA 2 cut(s) 285, 549
MslI CAYNNNNRTG 3 cut(s) 120, 815, 857
Msp20I TGGCCA 1 cut(s) 281
MspA1I CMGCKG 1 cut(s) 251
MspI CCGG 1 cut(s) 789
MspR9I CCNGG 1 cut(s) 790
MwoI GCNNNNNNNGC 3 cut(s) 269, 278, 387
NciI CCSGG 1 cut(s) 790
NcoI CCATGG 1 cut(s) 631
NdeII GATC 7 cut(s) 22, 175, 244, 253, 403, 483, 570
NlaIII CATG 6 cut(s) 557, 604, 635, 698, 762, 859
NlaIV GGNNCC 4 cut(s) 246, 572, 787, 793
NmeAIII GCCGAG 1 cut(s) 73
NmuCI GTSAC 1 cut(s) 454
NspI RCATGY 1 cut(s) 698
OliI CACNNNNGTG 1 cut(s) 815
PagI TCATGA 1 cut(s) 553
PciSI GCTCTTC 1 cut(s) 339
PdmI GAANNNNTTC 2 cut(s) 177, 348
PfeI GAWTC 1 cut(s) 194
Psp124BI GAGCTC 2 cut(s) 204, 506
PspN4I GGNNCC 4 cut(s) 246, 572, 787, 793
PspPI GGNCC 3 cut(s) 786, 792, 904
PsuI RGATCY 4 cut(s) 175, 244, 403, 570
PvuII CAGCTG 1 cut(s) 251
RsaI GTAC 4 cut(s) 230, 580, 731, 765
RsaNI GTAC 4 cut(s) 229, 579, 730, 764
RseI CAYNNNNRTG 3 cut(s) 120, 815, 857
SacI GAGCTC 2 cut(s) 204, 506
SapI GCTCTTC 1 cut(s) 339
SaqAI TTAA 2 cut(s) 285, 549
Sau3AI GATC 7 cut(s) 22, 175, 244, 253, 403, 483, 570
Sau96I GGNCC 3 cut(s) 786, 792, 904
ScaI AGTACT 1 cut(s) 731
ScrFI CCNGG 1 cut(s) 790
SduI GDGCHC 3 cut(s) 204, 392, 506
SfaNI GCATC 6 cut(s) 14, 34, 250, 517, 698, 793
SfcI CTRYAG 1 cut(s) 382
SinI GGWCC 3 cut(s) 786, 792, 904
SmiMI CAYNNNNRTG 3 cut(s) 120, 815, 857
SmlI CTYRAG 2 cut(s) 182, 844
SmoI CTYRAG 2 cut(s) 182, 844
Sse9I AATT 3 cut(s) 561, 652, 753
SsiI CCGC 3 cut(s) 224, 433, 466
SspI AATATT 1 cut(s) 517
SspMI CTAG 2 cut(s) 353, 407
SstI GAGCTC 2 cut(s) 204, 506
StyD4I CCNGG 1 cut(s) 788
StyI CCWWGG 2 cut(s) 393, 631
TaaI ACNGT 3 cut(s) 233, 476, 881
TaqI TCGA 2 cut(s) 318, 706
TaqII GACCGA 1 cut(s) 809
TasI AATT 3 cut(s) 561, 652, 753
TatI WGTACW 3 cut(s) 578, 729, 763
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 2 cut(s) 285, 549
Tru9I TTAA 2 cut(s) 285, 549
TscAI CASTG 2 cut(s) 427, 886
TseFI GTSAC 1 cut(s) 454
Tsp45I GTSAC 1 cut(s) 454
TspDTI ATGAA 4 cut(s) 171, 504, 570, 747
TspRI CASTG 2 cut(s) 427, 886
VpaK11BI GGWCC 3 cut(s) 786, 792, 904
XapI RAATTY 2 cut(s) 652, 753
XceI RCATGY 1 cut(s) 698
XmnI GAANNNNTTC 2 cut(s) 177, 348
XspI CTAG 2 cut(s) 353, 407
ZrmI AGTACT 1 cut(s) 731
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.