Rh1AG044600

Annexin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0001318
Physical Location & Seq
Forward (+)
7659735 .. 7660729
995 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG044600.1

Sequence Viewer

Length: 597 bp
ATGTCACAAGTTTATATGATACTAAAGAACATTTTGGCATGGGATGACATGTACAGAGAGCGGTGTACCATTGGACATGGGATCCAGCTGATTGTGATGCTGTTTTGGCTAATCTGGCCATCAAGAAACCCGAGTGCAACTACAATGTCATCATCAAAATCTTCAGTGTTCGGTGTCCTGAAGAGCGTAAGAAAAGCTTACCAGCTTCGTTACAAGTGCTCTTTGGAAGAAGATCTAGCTCAACATACCAATGGTGATATCCGCAAGCTTTTGGTTGCTTTGGTGACTGCTTACCTCTGTGACGGTAATGAGATTAATGTTAAGTTGGCAAATTCAGAAGCTAATATTCTTCAGGATGCTATCAAAGGCAAGTGTTTTAATCATGAAGAAATTATTAGAATCCTGAGTACACGAAGCAAGACACAGCTCATGGCAACATTCAACAAATACAGAGATGACCATGGCAACTCTATCAGCAAGAATTTCTTGGAGGATGGGGCTAATGATTTCCAGAAGGCATTGCATTGCATACTGCCGTTCGATGCCTCAATGACCACAAGAAGTGCTTTGAGAAGGTACTTCGCAAGGCGATCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Annexin

Protein Analysis

198

Amino Acids

22.69

Weight (kDa)

9.34

Isoelectric Point (pI)

54.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Annexin PF00191 60 - 94 1e-06 Annexin
Annexin PF00191 113 - 176 1.3e-12 Annexin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 61
AciI CCGC 2 cut(s) 61, 262
AclWI GGATC 2 cut(s) 76, 89
AcoI YGGCCR 1 cut(s) 116
AcsI RAATTY 2 cut(s) 331, 481
AcuI CTGAAG 3 cut(s) 147, 200, 335
AfaI GTAC 4 cut(s) 53, 67, 409, 578
AflIII ACRYGT 1 cut(s) 48
AgsI TTSAA 1 cut(s) 442
AluBI AGCT 7 cut(s) 88, 197, 205, 239, 268, 341, 427
AluI AGCT 7 cut(s) 88, 197, 205, 239, 268, 341, 427
Alw21I GWGCWC 1 cut(s) 221
AlwI GGATC 2 cut(s) 76, 89
Ama87I CYCGRG 1 cut(s) 130
AoxI GGCC 1 cut(s) 116
ApoI RAATTY 2 cut(s) 331, 481
AseI ATTAAT 1 cut(s) 315
AsuHPI GGTGA 2 cut(s) 266, 295
AvaI CYCGRG 1 cut(s) 130
BalI TGGCCA 1 cut(s) 118
BamHI GGATCC 1 cut(s) 81
Bbv12I GWGCWC 1 cut(s) 221
BccI CCATC 2 cut(s) 127, 488
BceAI ACGGC 1 cut(s) 520
BfaI CTAG 1 cut(s) 236
BglII AGATCT 1 cut(s) 232
BmeT110I CYCGRG 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 83
BmsI GCATC 3 cut(s) 87, 346, 532
BsaJI CCNNGG 1 cut(s) 460
Bse3DI GCAATG 2 cut(s) 518, 523
BseDI CCNNGG 1 cut(s) 460
BseGI GGATG 3 cut(s) 49, 361, 499
BseMI GCAATG 2 cut(s) 518, 523
BseMII CTCAG 1 cut(s) 395
BshFI GGCC 1 cut(s) 118
BsiHKAI GWGCWC 1 cut(s) 221
BsiHKCI CYCGRG 1 cut(s) 130
BsnI GGCC 1 cut(s) 118
BsoBI CYCGRG 1 cut(s) 130
Bsp1286I GDGCHC 1 cut(s) 221
Bsp1407I TGTACA 1 cut(s) 51
Bsp143I GATC 3 cut(s) 81, 232, 590
Bsp19I CCATGG 1 cut(s) 460
BspACI CCGC 2 cut(s) 61, 262
BspANI GGCC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 396
BspHI TCATGA 1 cut(s) 382
BspLI GGNNCC 1 cut(s) 83
BspPI GGATC 2 cut(s) 76, 89
BspQI GCTCTTC 1 cut(s) 176
BsrBI CCGCTC 1 cut(s) 61
BsrDI GCAATG 2 cut(s) 518, 523
BsrGI TGTACA 1 cut(s) 51
BssECI CCNNGG 1 cut(s) 460
BssMI GATC 3 cut(s) 81, 232, 590
BssT1I CCWWGG 1 cut(s) 460
Bst4CI ACNGT 1 cut(s) 305
Bst6I CTCTTC 1 cut(s) 176
BstAUI TGTACA 1 cut(s) 51
BstC8I GCNNGC 1 cut(s) 266
BstDEI CTNAG 1 cut(s) 404
BstDSI CCRYGG 1 cut(s) 460
BstF5I GGATG 3 cut(s) 49, 361, 499
BstKTI GATC 3 cut(s) 84, 235, 593
BstMBI GATC 3 cut(s) 81, 232, 590
BstMWI GCNNNNNNNGC 2 cut(s) 106, 115
BstNSI RCATGY 1 cut(s) 52
BstX2I RGATCY 2 cut(s) 81, 232
BstYI RGATCY 2 cut(s) 81, 232
BsuRI GGCC 1 cut(s) 118
BtgI CCRYGG 1 cut(s) 460
BtsCI GGATG 3 cut(s) 49, 361, 499
BtsIMutI CAGTG 1 cut(s) 171
Cac8I GCNNGC 1 cut(s) 266
CciI TCATGA 1 cut(s) 382
Csp6I GTAC 4 cut(s) 52, 66, 408, 577
CviAII CATG 6 cut(s) 39, 49, 77, 383, 430, 461
CviQI GTAC 4 cut(s) 52, 66, 408, 577
DdeI CTNAG 1 cut(s) 404
DpnI GATC 3 cut(s) 83, 234, 592
DpnII GATC 3 cut(s) 81, 232, 590
EaeI YGGCCR 1 cut(s) 116
Eam1104I CTCTTC 1 cut(s) 176
EarI CTCTTC 1 cut(s) 176
Eco130I CCWWGG 1 cut(s) 460
Eco32I GATATC 1 cut(s) 259
Eco57I CTGAAG 3 cut(s) 147, 200, 335
Eco88I CYCGRG 1 cut(s) 130
EcoRV GATATC 1 cut(s) 259
EcoT14I CCWWGG 1 cut(s) 460
ErhI CCWWGG 1 cut(s) 460
FaeI CATG 6 cut(s) 42, 52, 80, 386, 433, 464
FalI AAGNNNNNCTT 6 cut(s) 181, 213, 470, 502, 550, 582
FatI CATG 6 cut(s) 38, 48, 76, 382, 429, 460
FokI GGATG 3 cut(s) 56, 368, 506
FspBI CTAG 1 cut(s) 236
HaeIII GGCC 1 cut(s) 118
Hin1II CATG 6 cut(s) 42, 52, 80, 386, 433, 464
HindIII AAGCTT 2 cut(s) 195, 266
HinfI GANTC 1 cut(s) 399
HphI GGTGA 2 cut(s) 266, 295
Hpy166II GTNNAC 2 cut(s) 66, 410
Hpy188I TCNGA 1 cut(s) 337
Hpy188III TCNNGA 6 cut(s) 123, 178, 353, 383, 403, 511
Hpy8I GTNNAC 2 cut(s) 66, 410
HpyAV CCTTC 2 cut(s) 508, 567
HpyCH4III ACNGT 1 cut(s) 305
HpyCH4V TGCA 3 cut(s) 137, 523, 528
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 115
HpyF3I CTNAG 1 cut(s) 404
Hsp92II CATG 6 cut(s) 42, 52, 80, 386, 433, 464
Kzo9I GATC 3 cut(s) 81, 232, 590
LguI GCTCTTC 1 cut(s) 176
LpnPI CCDG 7 cut(s) 98, 100, 191, 215, 338, 416, 524
LweI GCATC 3 cut(s) 87, 346, 532
MaeI CTAG 1 cut(s) 236
MaeIII GTNAC 4 cut(s) 3, 209, 283, 299
MalI GATC 3 cut(s) 83, 234, 592
MbiI CCGCTC 1 cut(s) 61
MboI GATC 3 cut(s) 81, 232, 590
MboII GAAGA 6 cut(s) 153, 193, 239, 242, 341, 398
MflI RGATCY 2 cut(s) 81, 232
MhlI GDGCHC 1 cut(s) 221
MlsI TGGCCA 1 cut(s) 118
MluCI AATT 3 cut(s) 331, 390, 481
MluNI TGGCCA 1 cut(s) 118
MnlI CCTC 3 cut(s) 305, 484, 556
Mox20I TGGCCA 1 cut(s) 118
MscI TGGCCA 1 cut(s) 118
MseI TTAA 3 cut(s) 315, 321, 378
MslI CAYNNNNRTG 1 cut(s) 249
Msp20I TGGCCA 1 cut(s) 118
MspA1I CMGCKG 1 cut(s) 88
MwoI GCNNNNNNNGC 2 cut(s) 106, 115
NcoI CCATGG 1 cut(s) 460
NdeII GATC 3 cut(s) 81, 232, 590
NlaIII CATG 6 cut(s) 42, 52, 80, 386, 433, 464
NlaIV GGNNCC 1 cut(s) 83
NmuCI GTSAC 3 cut(s) 3, 283, 299
NspI RCATGY 1 cut(s) 52
PagI TCATGA 1 cut(s) 382
PciI ACATGT 1 cut(s) 48
PciSI GCTCTTC 1 cut(s) 176
PfeI GAWTC 1 cut(s) 399
PscI ACATGT 1 cut(s) 48
PshBI ATTAAT 1 cut(s) 315
PspN4I GGNNCC 1 cut(s) 83
PsuI RGATCY 2 cut(s) 81, 232
PvuII CAGCTG 1 cut(s) 88
RsaI GTAC 4 cut(s) 53, 67, 409, 578
RsaNI GTAC 4 cut(s) 52, 66, 408, 577
RseI CAYNNNNRTG 1 cut(s) 249
SapI GCTCTTC 1 cut(s) 176
SaqAI TTAA 3 cut(s) 315, 321, 378
Sau3AI GATC 3 cut(s) 81, 232, 590
SduI GDGCHC 1 cut(s) 221
SetI ASST 9 cut(s) 90, 199, 207, 241, 270, 297, 343, 429, 578
SfaNI GCATC 3 cut(s) 87, 346, 532
SmiMI CAYNNNNRTG 1 cut(s) 249
Sse9I AATT 3 cut(s) 331, 390, 481
SsiI CCGC 2 cut(s) 61, 262
SspI AATATT 1 cut(s) 346
SspMI CTAG 1 cut(s) 236
StyI CCWWGG 1 cut(s) 460
TaaI ACNGT 1 cut(s) 305
TaqI TCGA 1 cut(s) 540
TasI AATT 3 cut(s) 331, 390, 481
TatI WGTACW 2 cut(s) 51, 407
TfiI GAWTC 1 cut(s) 399
Tru1I TTAA 3 cut(s) 315, 321, 378
Tru9I TTAA 3 cut(s) 315, 321, 378
TscAI CASTG 1 cut(s) 171
TseFI GTSAC 3 cut(s) 3, 283, 299
Tsp45I GTSAC 3 cut(s) 3, 283, 299
TspDTI ATGAA 1 cut(s) 399
TspRI CASTG 1 cut(s) 171
VspI ATTAAT 1 cut(s) 315
XapI RAATTY 2 cut(s) 331, 481
XceI RCATGY 1 cut(s) 52
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.