RchiOBHm_Chr1g0351661

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001658
Physical Location & Seq
Forward (+)
44929781 .. 44930122
342 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57742

Sequence Viewer

Length: 141 bp
ATGCTACAACTGGACCAATCGTGCTTGGGTTTTGAAGATAATCGTGCTAGATCAACCAGGTGTTCGTCTACTGTGGGACTCCGCGTGGCTCTGGCTGCACGAACAGAGAGCATAGAGAGTTCAAGAATGATCGAGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

46

Amino Acids

5.12

Weight (kDa)

7.82

Isoelectric Point (pI)

98.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 68
AccII CGCG 1 cut(s) 84
AciI CCGC 1 cut(s) 82
AgsI TTSAA 2 cut(s) 35, 123
AjnI CCWGG 1 cut(s) 56
ApeKI GCWGC 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 13
AvaII GGWCC 1 cut(s) 13
BbvI GCAGC 1 cut(s) 82
BciT130I CCWGG 1 cut(s) 58
BfaI CTAG 1 cut(s) 48
BisI GCNGC 1 cut(s) 96
BlsI GCNGC 1 cut(s) 97
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 1 cut(s) 13
BmgT120I GGNCC 1 cut(s) 13
BmrFI CCNGG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 15
BseBI CCWGG 1 cut(s) 58
BseNI ACTGG 1 cut(s) 15
BseXI GCAGC 1 cut(s) 82
BsgI GTGCAG 1 cut(s) 81
Bsh1236I CGCG 1 cut(s) 84
BslFI GGGAC 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 90
Bsp143I GATC 2 cut(s) 50, 129
BspACI CCGC 1 cut(s) 82
BspFNI CGCG 1 cut(s) 84
BsrI ACTGG 1 cut(s) 15
BssMI GATC 2 cut(s) 50, 129
Bst2UI CCWGG 1 cut(s) 58
Bst4CI ACNGT 1 cut(s) 73
BstFNI CGCG 1 cut(s) 84
BstKTI GATC 2 cut(s) 53, 132
BstMBI GATC 2 cut(s) 50, 129
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstNI CCWGG 1 cut(s) 58
BstSCI CCNGG 1 cut(s) 56
BstUI CGCG 1 cut(s) 84
BstV1I GCAGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 13
CsiI ACCWGGT 1 cut(s) 56
CviJI RGCY 2 cut(s) 89, 95
CviKI_1 RGCY 2 cut(s) 89, 95
DpnI GATC 2 cut(s) 52, 131
DpnII GATC 2 cut(s) 50, 129
Eco47I GGWCC 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 56
FaiI YATR 1 cut(s) 113
FaqI GGGAC 1 cut(s) 90
FblI GTMKAC 1 cut(s) 68
Fnu4HI GCNGC 1 cut(s) 96
Fsp4HI GCNGC 1 cut(s) 96
FspBI CTAG 1 cut(s) 48
GluI GCNGC 1 cut(s) 96
HinfI GANTC 1 cut(s) 78
Hpy166II GTNNAC 1 cut(s) 69
Hpy188III TCNNGA 2 cut(s) 123, 133
Hpy8I GTNNAC 1 cut(s) 69
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
Kzo9I GATC 2 cut(s) 50, 129
LpnPI CCDG 3 cut(s) 43, 70, 77
Lsp1109I GCAGC 1 cut(s) 82
MabI ACCWGGT 1 cut(s) 56
MaeI CTAG 1 cut(s) 48
MalI GATC 2 cut(s) 52, 131
MboI GATC 2 cut(s) 50, 129
MboII GAAGA 1 cut(s) 47
MlyI GAGTC 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 58
MvaI CCWGG 1 cut(s) 58
MvnI CGCG 1 cut(s) 84
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeII GATC 2 cut(s) 50, 129
PkrI GCNGC 1 cut(s) 97
PleI GAGTC 1 cut(s) 72
PpsI GAGTC 1 cut(s) 72
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
PspPI GGNCC 1 cut(s) 13
SatI GCNGC 1 cut(s) 96
Sau3AI GATC 2 cut(s) 50, 129
Sau96I GGNCC 1 cut(s) 13
SchI GAGTC 1 cut(s) 72
ScrFI CCNGG 1 cut(s) 58
SetI ASST 1 cut(s) 62
SexAI ACCWGGT 1 cut(s) 56
SinI GGWCC 1 cut(s) 13
SsiI CCGC 1 cut(s) 82
SspMI CTAG 1 cut(s) 48
StyD4I CCNGG 1 cut(s) 56
TaaI ACNGT 1 cut(s) 73
TaqI TCGA 1 cut(s) 132
TseI GCWGC 1 cut(s) 95
VpaK11BI GGWCC 1 cut(s) 13
XmiI GTMKAC 1 cut(s) 68
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.