Rh2AG294700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
36320790 .. 36322174
1385 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG294700.1

Sequence Viewer

Length: 273 bp
ATGTGCGAGCTCCGCCTCACCCCGACGTACAATTATCTTATGGTCAAAATTGGATCCGACCTCTACCCCAAGCACAATTATCAATGTCTGGCTCAATTGCACTGTGAAAGTGATATTGGCTTAATCACTTTCAAAAATTGGACGCTTCTGGATAATTGTGTTTGGGTAGGTGATCTGCTACAACTAAACCAATCGTGCTTGGGTTTTGAAGATAATCGTCCTAGATCAACCAGAAAACAGAAGAAGTGTTGCTGGGTTTCGGATAGTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.52

Weight (kDa)

7.55

Isoelectric Point (pI)

40.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 13
AclWI GGATC 2 cut(s) 48, 61
AfaI GTAC 1 cut(s) 29
AgsI TTSAA 2 cut(s) 133, 209
AjuI GAANNNNNNNTTGG 2 cut(s) 99, 131
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
Alw21I GWGCWC 1 cut(s) 12
AlwI GGATC 2 cut(s) 48, 61
AsuHPI GGTGA 2 cut(s) 10, 182
BamHI GGATCC 1 cut(s) 53
BanII GRGCYC 1 cut(s) 12
Bbv12I GWGCWC 1 cut(s) 12
BfaI CTAG 1 cut(s) 222
BmiI GGNNCC 1 cut(s) 55
BseYI CCCAGC 1 cut(s) 252
BsiHKAI GWGCWC 1 cut(s) 12
Bsp1286I GDGCHC 1 cut(s) 12
Bsp143I GATC 3 cut(s) 53, 172, 224
BspACI CCGC 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 55
BspPI GGATC 2 cut(s) 48, 61
BssMI GATC 3 cut(s) 53, 172, 224
Bst4CI ACNGT 1 cut(s) 104
BstC8I GCNNGC 1 cut(s) 8
BstKTI GATC 3 cut(s) 56, 175, 227
BstMBI GATC 3 cut(s) 53, 172, 224
BstMWI GCNNNNNNNGC 1 cut(s) 12
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 100
Cac8I GCNNGC 1 cut(s) 8
CseI GACGC 1 cut(s) 151
Csp6I GTAC 1 cut(s) 28
CviJI RGCY 3 cut(s) 10, 92, 120
CviKI_1 RGCY 3 cut(s) 10, 92, 120
CviQI GTAC 1 cut(s) 28
DpnI GATC 3 cut(s) 55, 174, 226
DpnII GATC 3 cut(s) 53, 172, 224
Ecl136II GAGCTC 1 cut(s) 10
Eco24I GRGCYC 1 cut(s) 12
Eco53kI GAGCTC 1 cut(s) 10
EcoICRI GAGCTC 1 cut(s) 10
EcoT38I GRGCYC 1 cut(s) 12
FaiI YATR 1 cut(s) 41
FriOI GRGCYC 1 cut(s) 12
FspBI CTAG 1 cut(s) 222
GsaI CCCAGC 1 cut(s) 256
HgaI GACGC 1 cut(s) 151
HphI GGTGA 2 cut(s) 10, 182
Hpy188I TCNGA 2 cut(s) 58, 262
Hpy188III TCNNGA 1 cut(s) 149
Hpy99I CGWCG 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4IV ACGT 1 cut(s) 26
HpyCH4V TGCA 1 cut(s) 100
HpyF10VI GCNNNNNNNGC 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 26
Kzo9I GATC 3 cut(s) 53, 172, 224
LmnI GCTCC 1 cut(s) 15
LpnPI CCDG 4 cut(s) 74, 134, 238, 244
MaeI CTAG 1 cut(s) 222
MaeII ACGT 1 cut(s) 26
MalI GATC 3 cut(s) 55, 174, 226
MboI GATC 3 cut(s) 53, 172, 224
MboII GAAGA 2 cut(s) 221, 253
MfeI CAATTG 1 cut(s) 95
MflI RGATCY 1 cut(s) 53
MhlI GDGCHC 1 cut(s) 12
MluCI AATT 6 cut(s) 31, 48, 76, 95, 136, 154
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 2 cut(s) 26, 71
MseI TTAA 1 cut(s) 122
MunI CAATTG 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 12
NdeII GATC 3 cut(s) 53, 172, 224
NlaIV GGNNCC 1 cut(s) 55
Psp124BI GAGCTC 1 cut(s) 12
PspFI CCCAGC 1 cut(s) 252
PspN4I GGNNCC 1 cut(s) 55
PsuI RGATCY 1 cut(s) 53
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
SacI GAGCTC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 3 cut(s) 53, 172, 224
SduI GDGCHC 1 cut(s) 12
SetI ASST 4 cut(s) 12, 29, 63, 172
Sse9I AATT 6 cut(s) 31, 48, 76, 95, 136, 154
SsiI CCGC 1 cut(s) 13
SspMI CTAG 1 cut(s) 222
SstI GAGCTC 1 cut(s) 12
TaaI ACNGT 1 cut(s) 104
TaiI ACGT 1 cut(s) 29
TasI AATT 6 cut(s) 31, 48, 76, 95, 136, 154
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TscAI CASTG 1 cut(s) 107
TspRI CASTG 1 cut(s) 107
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.