Rh1CG270800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
53681303 .. 53684366
3064 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG270800.1

Sequence Viewer

Length: 210 bp
ATGCAACACATAGTTGCTTTAGGAAAAGCTCCATCTGATGCGCCCAGAGAGGGTAGTTCTTCCCATAGAAACGGACAGGAATGTATTCATCTTGCGTCTCTGGATAATTGTGTTTGGGTAGGTGATCTGCTGCAACTGGACCAATCGTGCTTGGGTTTTGAGGATAATCGTGCTAGATCAACCAGGGTCCCAGAAGTGCTAGAAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.59

Weight (kDa)

5.43

Isoelectric Point (pI)

65.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 50
AjnI CCWGG 1 cut(s) 182
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
Alw26I GTCTC 1 cut(s) 102
ApeKI GCWGC 1 cut(s) 130
Asp700I GAANNNNTTC 1 cut(s) 84
AspLEI GCGC 1 cut(s) 43
AspS9I GGNCC 2 cut(s) 139, 187
AsuHPI GGTGA 1 cut(s) 134
AvaII GGWCC 2 cut(s) 139, 187
BbvI GCAGC 1 cut(s) 117
BccI CCATC 1 cut(s) 40
BciT130I CCWGG 1 cut(s) 184
BcoDI GTCTC 1 cut(s) 102
BfaI CTAG 2 cut(s) 174, 200
BisI GCNGC 1 cut(s) 131
BlsI GCNGC 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 184
Bme18I GGWCC 2 cut(s) 139, 187
BmgT120I GGNCC 2 cut(s) 139, 187
BmiI GGNNCC 2 cut(s) 188, 189
BmrFI CCNGG 1 cut(s) 184
BmsI GCATC 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 183
Bsc4I CCNNNNNNNGG 1 cut(s) 50
Bse1I ACTGG 1 cut(s) 141
BseBI CCWGG 1 cut(s) 184
BseDI CCNNGG 1 cut(s) 183
BseLI CCNNNNNNNGG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 141
BseXI GCAGC 1 cut(s) 117
BslFI GGGAC 1 cut(s) 173
BslI CCNNNNNNNGG 1 cut(s) 50
BsmAI GTCTC 1 cut(s) 102
BsmBI CGTCTC 1 cut(s) 102
BsmFI GGGAC 1 cut(s) 173
Bsp143I GATC 2 cut(s) 124, 176
BspLI GGNNCC 2 cut(s) 188, 189
BsrI ACTGG 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 183
BssMI GATC 2 cut(s) 124, 176
Bst2UI CCWGG 1 cut(s) 184
BstHHI GCGC 1 cut(s) 43
BstKTI GATC 2 cut(s) 127, 179
BstMAI GTCTC 1 cut(s) 102
BstMBI GATC 2 cut(s) 124, 176
BstNI CCWGG 1 cut(s) 184
BstSCI CCNGG 1 cut(s) 182
BstV1I GCAGC 1 cut(s) 117
CfoI GCGC 1 cut(s) 43
Cfr13I GGNCC 2 cut(s) 139, 187
CseI GACGC 1 cut(s) 84
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
DpnI GATC 2 cut(s) 126, 178
DpnII GATC 2 cut(s) 124, 176
Eco47I GGWCC 2 cut(s) 139, 187
EcoO109I RGGNCCY 1 cut(s) 187
EcoRII CCWGG 1 cut(s) 182
Esp3I CGTCTC 1 cut(s) 102
FaiI YATR 2 cut(s) 11, 66
FaqI GGGAC 1 cut(s) 173
Fnu4HI GCNGC 1 cut(s) 131
Fsp4HI GCNGC 1 cut(s) 131
FspBI CTAG 2 cut(s) 174, 200
GlaI GCGC 1 cut(s) 42
GluI GCNGC 1 cut(s) 131
HgaI GACGC 1 cut(s) 84
HhaI GCGC 1 cut(s) 43
Hin6I GCGC 1 cut(s) 41
HinP1I GCGC 1 cut(s) 41
HphI GGTGA 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 101
HpyCH4V TGCA 2 cut(s) 4, 133
HspAI GCGC 1 cut(s) 41
KflI GGGWCCC 1 cut(s) 187
Kzo9I GATC 2 cut(s) 124, 176
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 7 cut(s) 58, 62, 86, 122, 169, 196, 204
Lsp1109I GCAGC 1 cut(s) 117
LweI GCATC 1 cut(s) 28
MaeI CTAG 2 cut(s) 174, 200
MalI GATC 2 cut(s) 126, 178
MboI GATC 2 cut(s) 124, 176
MboII GAAGA 1 cut(s) 51
MluCI AATT 1 cut(s) 106
MnlI CCTC 2 cut(s) 43, 154
MroXI GAANNNNTTC 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 184
MvaI CCWGG 1 cut(s) 184
NdeII GATC 2 cut(s) 124, 176
NlaIV GGNNCC 2 cut(s) 188, 189
PdmI GAANNNNTTC 1 cut(s) 84
PkrI GCNGC 1 cut(s) 132
PpuMI RGGWCCY 1 cut(s) 187
Psp5II RGGWCCY 1 cut(s) 187
Psp6I CCWGG 1 cut(s) 182
PspGI CCWGG 1 cut(s) 182
PspN4I GGNNCC 2 cut(s) 188, 189
PspPI GGNCC 2 cut(s) 139, 187
PspPPI RGGWCCY 1 cut(s) 187
SatI GCNGC 1 cut(s) 131
Sau3AI GATC 2 cut(s) 124, 176
Sau96I GGNCC 2 cut(s) 139, 187
ScrFI CCNGG 1 cut(s) 184
SetI ASST 2 cut(s) 31, 124
SfaNI GCATC 1 cut(s) 28
SinI GGWCC 2 cut(s) 139, 187
Sse9I AATT 1 cut(s) 106
SspMI CTAG 2 cut(s) 174, 200
StyD4I CCNGG 1 cut(s) 182
TasI AATT 1 cut(s) 106
TseI GCWGC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 77
TspGWI ACGGA 1 cut(s) 87
VpaK11BI GGWCC 2 cut(s) 139, 187
XmnI GAANNNNTTC 1 cut(s) 84
XspI CTAG 2 cut(s) 174, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.