RchiOBHm_Chr2g0141071

DNA repair protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001026
Physical Location & Seq
Reverse (-)
58647844 .. 58649525
1682 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51140

Sequence Viewer

Length: 165 bp
ATGGATAAAAGGATAGATACAGTGGCAAAACTGGGTTACAAGACGTGCATTGTACCAAAGTCAGCTGAAAAATCTGTAAGAGGAACTCTAGGTTTCGAGGATATCAAAATTATAGGCTGCAAGAATCTGAAAGAGGTCATCAACATCGTGTTTAGATCAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA_25 ChlI

Protein Analysis

54

Amino Acids

6.04

Weight (kDa)

9.57

Isoelectric Point (pI)

20.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 54
AjiI CACGTC 1 cut(s) 45
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
ApeKI GCWGC 1 cut(s) 117
BbvI GCAGC 1 cut(s) 104
BfaI CTAG 1 cut(s) 89
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
BmgBI CACGTC 1 cut(s) 45
BmrI ACTGGG 1 cut(s) 41
BmuI ACTGGG 1 cut(s) 41
Bse1I ACTGG 1 cut(s) 36
BseNI ACTGG 1 cut(s) 36
BseXI GCAGC 1 cut(s) 104
Bsp143I GATC 1 cut(s) 155
BsrI ACTGG 1 cut(s) 36
BssMI GATC 1 cut(s) 155
Bst4CI ACNGT 1 cut(s) 22
BstKTI GATC 1 cut(s) 158
BstMBI GATC 1 cut(s) 155
BstV1I GCAGC 1 cut(s) 104
BtrI CACGTC 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 27
Csp6I GTAC 1 cut(s) 53
CviJI RGCY 2 cut(s) 65, 117
CviKI_1 RGCY 2 cut(s) 65, 117
CviQI GTAC 1 cut(s) 53
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
Eco32I GATATC 1 cut(s) 103
EcoRV GATATC 1 cut(s) 103
FaiI YATR 1 cut(s) 113
Fnu4HI GCNGC 1 cut(s) 118
Fsp4HI GCNGC 1 cut(s) 118
FspBI CTAG 1 cut(s) 89
FspEI CC 9 cut(s) 8, 17, 18, 66, 69, 75, 83, 99, 119
GluI GCNGC 1 cut(s) 118
HinfI GANTC 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 129
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4IV ACGT 1 cut(s) 44
HpyCH4V TGCA 2 cut(s) 48, 120
HpySE526I ACGT 1 cut(s) 44
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 1 cut(s) 17
Lsp1109I GCAGC 1 cut(s) 104
MaeI CTAG 1 cut(s) 89
MaeII ACGT 1 cut(s) 44
MaeIII GTNAC 1 cut(s) 35
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MluCI AATT 1 cut(s) 108
MnlI CCTC 3 cut(s) 74, 91, 127
MspA1I CMGCKG 1 cut(s) 65
NdeII GATC 1 cut(s) 155
PfeI GAWTC 1 cut(s) 124
PkrI GCNGC 1 cut(s) 119
PvuII CAGCTG 1 cut(s) 65
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
SatI GCNGC 1 cut(s) 118
Sau3AI GATC 1 cut(s) 155
SetI ASST 4 cut(s) 47, 67, 94, 138
SgeI CNNG 7 cut(s) 44, 52, 57, 101, 109, 133, 160
Sse9I AATT 1 cut(s) 108
SspMI CTAG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 22
TaiI ACGT 1 cut(s) 47
TaqI TCGA 1 cut(s) 96
TasI AATT 1 cut(s) 108
TfiI GAWTC 1 cut(s) 124
TscAI CASTG 1 cut(s) 27
TseI GCWGC 1 cut(s) 117
TspRI CASTG 1 cut(s) 27
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.