RchiOBHm_Chr2g0168611

Synaptonemal complex protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
83036840 .. 83038881
2042 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53624

Sequence Viewer

Length: 240 bp
ATGATAAAATGGCCAAGTTCTATAGATCTTCAAGAAGATTCACCTCTAGTAGGAGCATCACAAACACCAGTGTCAACACTATTGAAGAAAGCTTCGGAGAATATGAATTCTCCAAATGTAATGAATATTTCAAAGCACCAAAAAAAGGTCATTTTTGATGAATATGAAGTTGAAACTGGTAATGGTAGAACTATTAAACTGAAAACAAGAAGCACAGACATGTTTGAGGATCCAAGATAA

Protein Analysis

79

Amino Acids

8.94

Weight (kDa)

6.56

Isoelectric Point (pI)

45.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 224, 237
AcoI YGGCCR 1 cut(s) 11
AcsI RAATTY 1 cut(s) 106
AfiI CCNNNNNNNGG 2 cut(s) 50, 145
AflIII ACRYGT 1 cut(s) 219
AgsI TTSAA 4 cut(s) 32, 85, 132, 173
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AlwI GGATC 2 cut(s) 224, 237
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 33
BalI TGGCCA 1 cut(s) 13
BamHI GGATCC 1 cut(s) 229
BfaI CTAG 1 cut(s) 47
BfmI CTRYAG 1 cut(s) 21
BglII AGATCT 1 cut(s) 25
BmiI GGNNCC 1 cut(s) 231
BmsI GCATC 1 cut(s) 65
Bsc4I CCNNNNNNNGG 2 cut(s) 50, 145
Bse1I ACTGG 2 cut(s) 68, 181
BseLI CCNNNNNNNGG 2 cut(s) 50, 145
BseNI ACTGG 2 cut(s) 68, 181
BshFI GGCC 1 cut(s) 13
BslI CCNNNNNNNGG 2 cut(s) 50, 145
BsnI GGCC 1 cut(s) 13
Bsp143I GATC 2 cut(s) 25, 229
BspANI GGCC 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 231
BspPI GGATC 2 cut(s) 224, 237
BsrI ACTGG 2 cut(s) 68, 181
BssMI GATC 2 cut(s) 25, 229
BstENI CCTNNNNNAGG 1 cut(s) 48
BstKTI GATC 2 cut(s) 28, 232
BstMBI GATC 2 cut(s) 25, 229
BstNSI RCATGY 1 cut(s) 223
BstSFI CTRYAG 1 cut(s) 21
BstX2I RGATCY 2 cut(s) 25, 229
BstYI RGATCY 2 cut(s) 25, 229
BsuRI GGCC 1 cut(s) 13
BtsIMutI CAGTG 1 cut(s) 75
CviAII CATG 1 cut(s) 220
CviJI RGCY 2 cut(s) 13, 92
CviKI_1 RGCY 2 cut(s) 13, 92
DpnI GATC 2 cut(s) 27, 231
DpnII GATC 2 cut(s) 25, 229
EaeI YGGCCR 1 cut(s) 11
EcoNI CCTNNNNNAGG 1 cut(s) 48
EcoRI GAATTC 1 cut(s) 106
FaeI CATG 1 cut(s) 223
FaiI YATR 4 cut(s) 23, 104, 165, 221
FatI CATG 1 cut(s) 219
FspBI CTAG 1 cut(s) 47
HaeIII GGCC 1 cut(s) 13
Hin1II CATG 1 cut(s) 223
HincII GTYRAC 1 cut(s) 75
HindII GTYRAC 1 cut(s) 75
HindIII AAGCTT 1 cut(s) 90
HinfI GANTC 1 cut(s) 38
HphI GGTGA 1 cut(s) 33
Hpy166II GTNNAC 1 cut(s) 75
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 32
Hpy8I GTNNAC 1 cut(s) 75
Hsp92II CATG 1 cut(s) 223
Kzo9I GATC 2 cut(s) 25, 229
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 2 cut(s) 81, 162
LweI GCATC 1 cut(s) 65
MaeI CTAG 1 cut(s) 47
MalI GATC 2 cut(s) 27, 231
MboI GATC 2 cut(s) 25, 229
MboII GAAGA 3 cut(s) 20, 47, 97
MflI RGATCY 2 cut(s) 25, 229
MlsI TGGCCA 1 cut(s) 13
MluCI AATT 1 cut(s) 106
MluNI TGGCCA 1 cut(s) 13
MnlI CCTC 2 cut(s) 54, 220
Mox20I TGGCCA 1 cut(s) 13
MscI TGGCCA 1 cut(s) 13
MseI TTAA 1 cut(s) 195
MslI CAYNNNNRTG 1 cut(s) 218
Msp20I TGGCCA 1 cut(s) 13
NdeII GATC 2 cut(s) 25, 229
NlaIII CATG 1 cut(s) 223
NlaIV GGNNCC 1 cut(s) 231
NspI RCATGY 1 cut(s) 223
PciI ACATGT 1 cut(s) 219
PfeI GAWTC 1 cut(s) 38
PscI ACATGT 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 231
PsuI RGATCY 2 cut(s) 25, 229
RseI CAYNNNNRTG 1 cut(s) 218
SaqAI TTAA 1 cut(s) 195
Sau3AI GATC 2 cut(s) 25, 229
SetI ASST 3 cut(s) 46, 94, 150
SfaNI GCATC 1 cut(s) 65
SfcI CTRYAG 1 cut(s) 21
SgeI CNNG 7 cut(s) 27, 44, 59, 80, 189, 219, 232
SmiMI CAYNNNNRTG 1 cut(s) 218
Sse9I AATT 1 cut(s) 106
SspI AATATT 1 cut(s) 127
SspMI CTAG 1 cut(s) 47
TasI AATT 1 cut(s) 106
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TscAI CASTG 1 cut(s) 75
TspDTI ATGAA 4 cut(s) 119, 137, 174, 180
TspRI CASTG 1 cut(s) 75
XagI CCTNNNNNAGG 1 cut(s) 48
XapI RAATTY 1 cut(s) 106
XceI RCATGY 1 cut(s) 223
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.