RchiOBHm_Chr7g0243501

Synaptonemal complex protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
69748373 .. 69749017
645 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21822

Sequence Viewer

Length: 198 bp
ATGCTCGATCTCCATTTTCACCTTCAGAATTATGATCCAAGAAAACATAAGAGGACAAGTACACCAAAAGTCAAAAGCCCCAGGAGTGTGGTCAAGGGATCTAAGGGAGAGGGTCAACCACGTCCTTCAAACATCGTTGACCTGTTTTCTAAAGGGTCTCTGAATCCATATGCTGATGATCCATATGCATTTGATTAA

Protein Analysis

65

Amino Acids

7.37

Weight (kDa)

9.63

Isoelectric Point (pI)

47.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 29, 106, 173
AcuI CTGAAG 1 cut(s) 8
AfaI GTAC 1 cut(s) 61
AgsI TTSAA 1 cut(s) 129
AjiI CACGTC 1 cut(s) 122
AjnI CCWGG 1 cut(s) 80
Alw26I GTCTC 1 cut(s) 162
AlwI GGATC 3 cut(s) 29, 106, 173
AsuHPI GGTGA 1 cut(s) 11
BciT130I CCWGG 1 cut(s) 82
BcoDI GTCTC 1 cut(s) 162
Bme1390I CCNGG 1 cut(s) 82
BmgBI CACGTC 1 cut(s) 122
BmrFI CCNGG 1 cut(s) 82
BsaI GGTCTC 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 80
BseBI CCWGG 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 80
BsmAI GTCTC 1 cut(s) 162
Bso31I GGTCTC 1 cut(s) 162
Bsp143I GATC 4 cut(s) 7, 34, 98, 178
BspPI GGATC 3 cut(s) 29, 106, 173
BspTNI GGTCTC 1 cut(s) 162
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 4 cut(s) 7, 34, 98, 178
Bst2UI CCWGG 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 102
BstKTI GATC 4 cut(s) 10, 37, 101, 181
BstMAI GTCTC 1 cut(s) 162
BstMBI GATC 4 cut(s) 7, 34, 98, 178
BstNI CCWGG 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 80
BstX2I RGATCY 1 cut(s) 98
BstXI CCANNNNNNTGG 1 cut(s) 88
BstYI RGATCY 1 cut(s) 98
BtrI CACGTC 1 cut(s) 122
Csp6I GTAC 1 cut(s) 60
CviJI RGCY 1 cut(s) 78
CviKI_1 RGCY 1 cut(s) 78
CviQI GTAC 1 cut(s) 60
DdeI CTNAG 1 cut(s) 102
DpnI GATC 4 cut(s) 9, 36, 100, 180
DpnII GATC 4 cut(s) 7, 34, 98, 178
Eco31I GGTCTC 1 cut(s) 162
Eco57I CTGAAG 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 80
EcoT22I ATGCAT 1 cut(s) 190
FaiI YATR 6 cut(s) 33, 48, 169, 171, 184, 186
FauNDI CATATG 2 cut(s) 169, 184
HincII GTYRAC 2 cut(s) 116, 139
HindII GTYRAC 2 cut(s) 116, 139
HinfI GANTC 1 cut(s) 163
HphI GGTGA 1 cut(s) 11
Hpy166II GTNNAC 3 cut(s) 62, 116, 139
Hpy188I TCNGA 2 cut(s) 27, 162
Hpy8I GTNNAC 3 cut(s) 62, 116, 139
HpyAV CCTTC 2 cut(s) 32, 135
HpyCH4IV ACGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 188
HpyF3I CTNAG 1 cut(s) 102
HpySE526I ACGT 1 cut(s) 121
Kzo9I GATC 4 cut(s) 7, 34, 98, 178
LpnPI CCDG 3 cut(s) 67, 94, 155
MaeII ACGT 1 cut(s) 121
MalI GATC 4 cut(s) 9, 36, 100, 180
MboI GATC 4 cut(s) 7, 34, 98, 178
MflI RGATCY 1 cut(s) 98
MluCI AATT 1 cut(s) 28
MnlI CCTC 2 cut(s) 45, 103
Mph1103I ATGCAT 1 cut(s) 190
MseI TTAA 1 cut(s) 196
MspR9I CCNGG 1 cut(s) 82
MvaI CCWGG 1 cut(s) 82
NdeI CATATG 2 cut(s) 169, 184
NdeII GATC 4 cut(s) 7, 34, 98, 178
NsiI ATGCAT 1 cut(s) 190
PfeI GAWTC 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
PsuI RGATCY 1 cut(s) 98
RsaI GTAC 1 cut(s) 61
RsaNI GTAC 1 cut(s) 60
SaqAI TTAA 1 cut(s) 196
Sau3AI GATC 4 cut(s) 7, 34, 98, 178
ScrFI CCNGG 1 cut(s) 82
SetI ASST 3 cut(s) 24, 124, 144
SgeI CNNG 8 cut(s) 17, 51, 69, 93, 94, 106, 132, 154
Sse9I AATT 1 cut(s) 28
StyD4I CCNGG 1 cut(s) 80
TaiI ACGT 1 cut(s) 124
TaqI TCGA 1 cut(s) 6
TasI AATT 1 cut(s) 28
TatI WGTACW 1 cut(s) 59
TfiI GAWTC 1 cut(s) 163
Tru1I TTAA 1 cut(s) 196
Tru9I TTAA 1 cut(s) 196
Zsp2I ATGCAT 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.