Rh5CG411900

Synaptonemal complex protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
55649977 .. 55652034
2058 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG411900.1

Sequence Viewer

Length: 297 bp
ATGAAGATATATTTCCACAACCAAACCCTGAGAATATGCCATGTGAGTCTTCGGGTTCAGGTGAACCACAACCTTCAACCTACATCTCAAAATGATAATAGCCAACCTAATGAGGTTGGCATTGAACCTACTGATCCCAACAAAGAAGATGTGCTGAAAATCTCAGCAGTAGAAATGGAGAATAAAGATAAGACAGAGAAACTACAAGTAGAGGTATGGAAGAAAGTGGAACAAATAGATAGTTTACTGAAGGAAGGTGAAACACATGAGCAACATGTAGATTTGATGGATAAATAA

Protein Analysis

98

Amino Acids

11.43

Weight (kDa)

5.28

Isoelectric Point (pI)

44.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 128
AcuI CTGAAG 1 cut(s) 269
AflIII ACRYGT 1 cut(s) 274
AgsI TTSAA 2 cut(s) 77, 125
AlwI GGATC 1 cut(s) 128
AsuHPI GGTGA 2 cut(s) 73, 269
BbsI GAAGAC 1 cut(s) 41
BccI CCATC 1 cut(s) 280
BpiI GAAGAC 1 cut(s) 41
BseMII CTCAG 2 cut(s) 20, 177
Bsp143I GATC 1 cut(s) 133
BspCNI CTCAG 2 cut(s) 21, 176
BspPI GGATC 1 cut(s) 128
BssMI GATC 1 cut(s) 133
BstDEI CTNAG 2 cut(s) 29, 163
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstNSI RCATGY 1 cut(s) 278
BstV2I GAAGAC 1 cut(s) 41
CviAII CATG 3 cut(s) 41, 266, 275
CviJI RGCY 1 cut(s) 102
CviKI_1 RGCY 1 cut(s) 102
DdeI CTNAG 2 cut(s) 29, 163
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
Eco57I CTGAAG 1 cut(s) 269
FaeI CATG 3 cut(s) 44, 269, 278
FaiI YATR 6 cut(s) 10, 37, 42, 217, 267, 276
FatI CATG 3 cut(s) 40, 265, 274
Hin1II CATG 3 cut(s) 44, 269, 278
HinfI GANTC 1 cut(s) 46
HphI GGTGA 2 cut(s) 73, 269
Hpy166II GTNNAC 2 cut(s) 64, 245
Hpy8I GTNNAC 2 cut(s) 64, 245
HpyAV CCTTC 3 cut(s) 83, 244, 248
HpyF3I CTNAG 2 cut(s) 29, 163
Hsp92II CATG 3 cut(s) 44, 269, 278
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 2 cut(s) 41, 44
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 4 cut(s) 16, 41, 158, 232
MlyI GAGTC 1 cut(s) 55
MnlI CCTC 2 cut(s) 106, 205
NdeII GATC 1 cut(s) 133
NlaIII CATG 3 cut(s) 44, 269, 278
NspI RCATGY 1 cut(s) 278
PciI ACATGT 1 cut(s) 274
PleI GAGTC 1 cut(s) 54
PpsI GAGTC 1 cut(s) 54
PscI ACATGT 1 cut(s) 274
Sau3AI GATC 1 cut(s) 133
SchI GAGTC 1 cut(s) 55
SetI ASST 8 cut(s) 63, 75, 82, 109, 117, 130, 216, 259
SgeI CNNG 7 cut(s) 40, 53, 65, 71, 218, 278, 287
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.