Rh5BG532300

Synaptonemal complex protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
83802215 .. 83803352
1138 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG532300.1

Sequence Viewer

Length: 156 bp
ATGTTTGAGAGGACAAGTACACCAAAAGTCAAAAGCCCCAGGAGTGTAGTCAAGGGATCTAAGGGAGAGGGTCAACCACGTCCTTCAAACATCGGTGACCTGTTTTCAGAAGGGTCTCTGAATCCATTTGCTGATGATCCATATGCATTTGATTAA

Protein Analysis

51

Amino Acids

5.55

Weight (kDa)

6.13

Isoelectric Point (pI)

48.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 64, 131
AfaI GTAC 1 cut(s) 19
AgsI TTSAA 1 cut(s) 87
AjiI CACGTC 1 cut(s) 80
AjnI CCWGG 1 cut(s) 38
Alw26I GTCTC 1 cut(s) 120
AlwI GGATC 2 cut(s) 64, 131
AsuHPI GGTGA 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 40
BcoDI GTCTC 1 cut(s) 120
Bme1390I CCNGG 1 cut(s) 40
BmgBI CACGTC 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 40
BsaI GGTCTC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 38
BseBI CCWGG 1 cut(s) 40
BseDI CCNNGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 120
Bso31I GGTCTC 1 cut(s) 120
Bsp143I GATC 2 cut(s) 56, 136
BspPI GGATC 2 cut(s) 64, 131
BspTNI GGTCTC 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 38
BssMI GATC 2 cut(s) 56, 136
Bst2UI CCWGG 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 60
BstEII GGTNACC 1 cut(s) 95
BstKTI GATC 2 cut(s) 59, 139
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 2 cut(s) 56, 136
BstNI CCWGG 1 cut(s) 40
BstPI GGTNACC 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BtrI CACGTC 1 cut(s) 80
Csp6I GTAC 1 cut(s) 18
CviJI RGCY 1 cut(s) 36
CviKI_1 RGCY 1 cut(s) 36
CviQI GTAC 1 cut(s) 18
DdeI CTNAG 1 cut(s) 60
DpnI GATC 2 cut(s) 58, 138
DpnII GATC 2 cut(s) 56, 136
Eco31I GGTCTC 1 cut(s) 120
Eco91I GGTNACC 1 cut(s) 95
EcoO65I GGTNACC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 38
EcoT22I ATGCAT 1 cut(s) 148
FaiI YATR 2 cut(s) 142, 144
FauNDI CATATG 1 cut(s) 142
HincII GTYRAC 1 cut(s) 74
HindII GTYRAC 1 cut(s) 74
HinfI GANTC 1 cut(s) 121
HphI GGTGA 1 cut(s) 107
Hpy166II GTNNAC 2 cut(s) 20, 74
Hpy188I TCNGA 2 cut(s) 109, 120
Hpy8I GTNNAC 2 cut(s) 20, 74
HpyAV CCTTC 2 cut(s) 93, 104
HpyCH4IV ACGT 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 60
HpySE526I ACGT 1 cut(s) 79
Kzo9I GATC 2 cut(s) 56, 136
LpnPI CCDG 3 cut(s) 25, 52, 113
MaeII ACGT 1 cut(s) 79
MaeIII GTNAC 1 cut(s) 95
MalI GATC 2 cut(s) 58, 138
MboI GATC 2 cut(s) 56, 136
MflI RGATCY 1 cut(s) 56
MnlI CCTC 2 cut(s) 3, 61
Mph1103I ATGCAT 1 cut(s) 148
MseI TTAA 1 cut(s) 154
MspR9I CCNGG 1 cut(s) 40
MvaI CCWGG 1 cut(s) 40
NdeI CATATG 1 cut(s) 142
NdeII GATC 2 cut(s) 56, 136
NmuCI GTSAC 1 cut(s) 95
NsiI ATGCAT 1 cut(s) 148
PfeI GAWTC 1 cut(s) 121
Psp6I CCWGG 1 cut(s) 38
PspEI GGTNACC 1 cut(s) 95
PspGI CCWGG 1 cut(s) 38
PsuI RGATCY 1 cut(s) 56
RsaI GTAC 1 cut(s) 19
RsaNI GTAC 1 cut(s) 18
SaqAI TTAA 1 cut(s) 154
Sau3AI GATC 2 cut(s) 56, 136
ScrFI CCNGG 1 cut(s) 40
SetI ASST 2 cut(s) 82, 102
SgeI CNNG 6 cut(s) 27, 51, 52, 64, 90, 112
StyD4I CCNGG 1 cut(s) 38
TaiI ACGT 1 cut(s) 82
TatI WGTACW 1 cut(s) 17
TfiI GAWTC 1 cut(s) 121
Tru1I TTAA 1 cut(s) 154
Tru9I TTAA 1 cut(s) 154
TseFI GTSAC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 95
Zsp2I ATGCAT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.