RchiOBHm_Chr4g0385671

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
1243891 .. 1246186
2296 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35911

Sequence Viewer

Length: 228 bp
ATGAGAAAGGACCTCAGCAGCAGATGGAAGGTCAGAAAAATTGAAGAAGAGCTGTTAGTGGTAGTAGCAAAGATCATATTGTCAGTATTGGCGGGTGGGTTTCTGCTGGTGTTCTCACATCTCTATGAGCAACTTATATTGAGGCCTAAAGGGCTAAGATCAAAGCTCCAAAAGCAAGAAATTAGAGGGCGTCCTCCTTCATTCCTCTTGGGGAATATCCTTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.61

Weight (kDa)

10.7

Isoelectric Point (pI)

78.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AcyI GRCGYC 1 cut(s) 190
AgsI TTSAA 1 cut(s) 44
AluBI AGCT 2 cut(s) 52, 166
AluI AGCT 2 cut(s) 52, 166
AoxI GGCC 1 cut(s) 143
ApeKI GCWGC 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 10
AvaII GGWCC 1 cut(s) 10
BbvCI CCTCAGC 1 cut(s) 14
BbvI GCAGC 1 cut(s) 30
BccI CCATC 1 cut(s) 18
BglI GCCNNNNNGGC 1 cut(s) 151
BisI GCNGC 1 cut(s) 19
BlsI GCNGC 1 cut(s) 20
Bme18I GGWCC 1 cut(s) 10
BmgT120I GGNCC 1 cut(s) 10
Bpu10I CCTNAGC 1 cut(s) 14
BsaHI GRCGYC 1 cut(s) 190
BseMII CTCAG 1 cut(s) 28
BseXI GCAGC 1 cut(s) 30
BshFI GGCC 1 cut(s) 145
BsnI GGCC 1 cut(s) 145
Bsp143I GATC 2 cut(s) 72, 158
BspACI CCGC 1 cut(s) 92
BspANI GGCC 1 cut(s) 145
BspCNI CTCAG 1 cut(s) 27
BspQI GCTCTTC 1 cut(s) 42
BssMI GATC 2 cut(s) 72, 158
BssNI GRCGYC 1 cut(s) 190
Bst6I CTCTTC 1 cut(s) 42
BstACI GRCGYC 1 cut(s) 190
BstDEI CTNAG 2 cut(s) 14, 155
BstKTI GATC 2 cut(s) 75, 161
BstMBI GATC 2 cut(s) 72, 158
BstMWI GCNNNNNNNGC 2 cut(s) 151, 172
BstV1I GCAGC 1 cut(s) 30
BsuRI GGCC 1 cut(s) 145
Cfr13I GGNCC 1 cut(s) 10
CseI GACGC 1 cut(s) 179
CviJI RGCY 4 cut(s) 52, 145, 154, 166
CviKI_1 RGCY 4 cut(s) 52, 145, 154, 166
DdeI CTNAG 2 cut(s) 14, 155
DpnI GATC 2 cut(s) 74, 160
DpnII GATC 2 cut(s) 72, 158
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
Eco147I AGGCCT 1 cut(s) 145
Eco47I GGWCC 1 cut(s) 10
EcoO109I RGGNCCY 1 cut(s) 10
FaiI YATR 4 cut(s) 77, 126, 137, 226
FauI CCCGC 1 cut(s) 85
Fnu4HI GCNGC 1 cut(s) 19
Fsp4HI GCNGC 1 cut(s) 19
GluI GCNGC 1 cut(s) 19
HaeIII GGCC 1 cut(s) 145
HgaI GACGC 1 cut(s) 179
Hin1I GRCGYC 1 cut(s) 190
Hpy188I TCNGA 1 cut(s) 35
HpyAV CCTTC 2 cut(s) 22, 207
HpyCH4V TGCA 1 cut(s) 224
HpyF10VI GCNNNNNNNGC 2 cut(s) 151, 172
HpyF3I CTNAG 2 cut(s) 14, 155
Hsp92I GRCGYC 1 cut(s) 190
Kzo9I GATC 2 cut(s) 72, 158
LguI GCTCTTC 1 cut(s) 42
LmnI GCTCC 1 cut(s) 171
LpnPI CCDG 1 cut(s) 92
Lsp1109I GCAGC 1 cut(s) 30
MalI GATC 2 cut(s) 74, 160
MboI GATC 2 cut(s) 72, 158
MboII GAAGA 2 cut(s) 56, 59
MluCI AATT 2 cut(s) 39, 180
MnlI CCTC 5 cut(s) 23, 135, 179, 204, 215
MslI CAYNNNNRTG 1 cut(s) 123
MwoI GCNNNNNNNGC 2 cut(s) 151, 172
NdeII GATC 2 cut(s) 72, 158
PceI AGGCCT 1 cut(s) 145
PciSI GCTCTTC 1 cut(s) 42
PkrI GCNGC 1 cut(s) 20
PpuMI RGGWCCY 1 cut(s) 10
Psp5II RGGWCCY 1 cut(s) 10
PspPI GGNCC 1 cut(s) 10
PspPPI RGGWCCY 1 cut(s) 10
RseI CAYNNNNRTG 1 cut(s) 123
SapI GCTCTTC 1 cut(s) 42
SatI GCNGC 1 cut(s) 19
Sau3AI GATC 2 cut(s) 72, 158
Sau96I GGNCC 1 cut(s) 10
SetI ASST 4 cut(s) 15, 33, 54, 168
SgeI CNNG 4 cut(s) 105, 119, 188, 220
SinI GGWCC 1 cut(s) 10
SmiMI CAYNNNNRTG 1 cut(s) 123
Sse9I AATT 2 cut(s) 39, 180
SseBI AGGCCT 1 cut(s) 145
SsiI CCGC 1 cut(s) 92
StuI AGGCCT 1 cut(s) 145
TasI AATT 2 cut(s) 39, 180
TseI GCWGC 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 189
VpaK11BI GGWCC 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.