RchiOBHm_Chr4g0414571

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
39063944 .. 39065851
1908 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38496

Sequence Viewer

Length: 138 bp
ATGGACAAATCCTGTGATACATGTGCTGAATTTACTGATCGAGGCATTGCTTTTAAAGAAGTGATTATAACATGCTCTAAATGCAGAATAGCTCGTGAAGATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

4.97

Weight (kDa)

5.04

Isoelectric Point (pI)

11.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 68
AcsI RAATTY 1 cut(s) 29
AflIII ACRYGT 1 cut(s) 20
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
ApoI RAATTY 1 cut(s) 29
BauI CACGAG 1 cut(s) 93
BglII AGATCT 1 cut(s) 100
Bse3DI GCAATG 1 cut(s) 45
BseMI GCAATG 1 cut(s) 45
Bsp143I GATC 2 cut(s) 37, 100
BsrDI GCAATG 1 cut(s) 45
BssMI GATC 2 cut(s) 37, 100
BssSI CACGAG 1 cut(s) 93
Bst2BI CACGAG 1 cut(s) 93
BstKTI GATC 2 cut(s) 40, 103
BstMBI GATC 2 cut(s) 37, 100
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstNSI RCATGY 2 cut(s) 24, 75
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
CviAII CATG 2 cut(s) 21, 72
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
DpnI GATC 2 cut(s) 39, 102
DpnII GATC 2 cut(s) 37, 100
DraI TTTAAA 1 cut(s) 55
FaeI CATG 2 cut(s) 24, 75
FaiI YATR 3 cut(s) 22, 68, 73
FatI CATG 2 cut(s) 20, 71
FspEI CC 2 cut(s) 25, 27
Hin1II CATG 2 cut(s) 24, 75
Hpy188III TCNNGA 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 84
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
Hsp92II CATG 2 cut(s) 24, 75
Kzo9I GATC 2 cut(s) 37, 100
LpnPI CCDG 1 cut(s) 25
MalI GATC 2 cut(s) 39, 102
MboI GATC 2 cut(s) 37, 100
MboII GAAGA 1 cut(s) 110
MflI RGATCY 1 cut(s) 100
MluCI AATT 1 cut(s) 29
MnlI CCTC 1 cut(s) 35
MseI TTAA 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 81
NdeII GATC 2 cut(s) 37, 100
NlaIII CATG 2 cut(s) 24, 75
NspI RCATGY 2 cut(s) 24, 75
PciI ACATGT 1 cut(s) 20
PscI ACATGT 1 cut(s) 20
PsiI TTATAA 1 cut(s) 68
PsuI RGATCY 1 cut(s) 100
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 2 cut(s) 37, 100
SetI ASST 1 cut(s) 94
SgeI CNNG 6 cut(s) 24, 33, 53, 84, 105, 107
Sse9I AATT 1 cut(s) 29
TaqI TCGA 1 cut(s) 40
TasI AATT 1 cut(s) 29
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
XapI RAATTY 1 cut(s) 29
XceI RCATGY 2 cut(s) 24, 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.