Rh4CG197200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
42097958 .. 42098278
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG197200.1

Sequence Viewer

Length: 321 bp
ATGGCTCTTGTGCATATTGTGGAAAGTCCATGTCAAATTGGCAGAATATCAATGTGCATACTGTCCTTTTCAGAAAAAAACCCTGTGATATCCATTATCTCTTCTGGATTTTCTTTTTTAATGTGTATCTCTTCAACTTTTCAGGACAAACCTGGTGATATATGTGCTGGATTTACTGATCGAGGCATTGCTTCTGAAGAAGTCATTATAACCTGTTCTAAATGCAGAATAGCTCGTGAACATATGTCATTTGTAGGCTTCTTTCTGACTATTTTTCTTTGTTTGAGCGGTTTTCAAATTTCTCAGTTTATTACAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.67

Weight (kDa)

6.03

Isoelectric Point (pI)

35.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 209
AccBSI CCGCTC 1 cut(s) 288
AciI CCGC 1 cut(s) 288
AcsI RAATTY 1 cut(s) 297
AcuI CTGAAG 1 cut(s) 216
AgsI TTSAA 2 cut(s) 135, 296
AjnI CCWGG 1 cut(s) 151
AluBI AGCT 1 cut(s) 233
AluI AGCT 1 cut(s) 233
ApoI RAATTY 1 cut(s) 297
AsuHPI GGTGA 1 cut(s) 167
BauI CACGAG 1 cut(s) 234
BciT130I CCWGG 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 153
Bse3DI GCAATG 1 cut(s) 186
BseBI CCWGG 1 cut(s) 153
BseMI GCAATG 1 cut(s) 186
BseMII CTCAG 1 cut(s) 317
Bsp143I GATC 1 cut(s) 178
BspACI CCGC 1 cut(s) 288
BspCNI CTCAG 1 cut(s) 316
BsrBI CCGCTC 1 cut(s) 288
BsrDI GCAATG 1 cut(s) 186
BssMI GATC 1 cut(s) 178
BssSI CACGAG 1 cut(s) 234
Bst2BI CACGAG 1 cut(s) 234
Bst2UI CCWGG 1 cut(s) 153
Bst4CI ACNGT 1 cut(s) 63
Bst6I CTCTTC 2 cut(s) 106, 136
BstDEI CTNAG 1 cut(s) 303
BstKTI GATC 1 cut(s) 181
BstMBI GATC 1 cut(s) 178
BstNI CCWGG 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 151
CsiI ACCWGGT 1 cut(s) 151
CviAII CATG 1 cut(s) 30
CviJI RGCY 3 cut(s) 5, 233, 258
CviKI_1 RGCY 3 cut(s) 5, 233, 258
DdeI CTNAG 1 cut(s) 303
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
Eam1104I CTCTTC 2 cut(s) 106, 136
EarI CTCTTC 2 cut(s) 106, 136
Eco32I GATATC 1 cut(s) 90
Eco57I CTGAAG 1 cut(s) 216
EcoRII CCWGG 1 cut(s) 151
EcoRV GATATC 1 cut(s) 90
FaeI CATG 1 cut(s) 33
FaiI YATR 8 cut(s) 15, 31, 59, 161, 163, 209, 243, 245
FatI CATG 1 cut(s) 29
FauNDI CATATG 1 cut(s) 243
Hin1II CATG 1 cut(s) 33
HphI GGTGA 1 cut(s) 167
Hpy166II GTNNAC 1 cut(s) 239
Hpy188I TCNGA 3 cut(s) 73, 196, 267
Hpy188III TCNNGA 3 cut(s) 105, 143, 236
Hpy8I GTNNAC 1 cut(s) 239
HpyCH4III ACNGT 1 cut(s) 63
HpyCH4V TGCA 3 cut(s) 13, 57, 225
HpyF3I CTNAG 1 cut(s) 303
Hsp92II CATG 1 cut(s) 33
Kzo9I GATC 1 cut(s) 178
LpnPI CCDG 7 cut(s) 90, 96, 128, 138, 153, 165, 226
MabI ACCWGGT 1 cut(s) 151
MalI GATC 1 cut(s) 180
MbiI CCGCTC 1 cut(s) 288
MboI GATC 1 cut(s) 178
MboII GAAGA 3 cut(s) 93, 123, 209
MluCI AATT 2 cut(s) 36, 297
MnlI CCTC 1 cut(s) 176
MseI TTAA 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 153
MvaI CCWGG 1 cut(s) 153
NdeI CATATG 1 cut(s) 243
NdeII GATC 1 cut(s) 178
NlaIII CATG 1 cut(s) 33
PsiI TTATAA 1 cut(s) 209
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
SaqAI TTAA 1 cut(s) 119
Sau3AI GATC 1 cut(s) 178
ScrFI CCNGG 1 cut(s) 153
SetI ASST 3 cut(s) 154, 215, 235
SexAI ACCWGGT 1 cut(s) 151
Sse9I AATT 2 cut(s) 36, 297
SsiI CCGC 1 cut(s) 288
StyD4I CCNGG 1 cut(s) 151
TaaI ACNGT 1 cut(s) 63
TaqI TCGA 1 cut(s) 181
TasI AATT 2 cut(s) 36, 297
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
XapI RAATTY 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.