Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001063.1

Orthogroup ID

OG0001632

Physical Location & Seq

Genomic Coordinates Forward (+)

76485 .. 77811

Gene Structure 1327 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001063.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 336 bp

atgcctcccgtcttacgggccaatttgcttcttagattgcttctttgggctgatcccttccgagaggaatgtcctgatcttcaagatgttggactttactttttccctgatgataacattgccagatcaagagagaccaatgctttgctgttggaggtcatggatacccaaaattcagtgatgaggatttactttgatggagtggatgctgtggatttgttgatatttacatctaaacagctgcatttagacttgctgaaggagcctatcatgaaggatgagcattctgcatcctcggacagcgtgttgcatgcaagtgaatttggagaaggatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3

Protein Analysis

111

Amino Acids

12.63

Weight (kDa)

4.4

Isoelectric Point (pI)

46.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001632)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G61090 AT5G61090 AT5G61120 AT5G61120 AT5G61120
fragaria_vesca	FvH4_4g13540 FvH4_4g13550 FvH4_5g13930 FvH4_5g13940 FvH4_5g13940 FvH4_5g13940
malus_domestica	MD06G1202200.v1.1 MD14G1211300.v1.1
prunus_persica	Prupe.5G204200_v2.0.a1 Prupe.5G204200_v2.0.a1 Prupe.5G204400_v2.0.a1
pyrus_communis	pycom06g17820
rosa_chinensis	RchiOBHm_Chr4g0414551 RchiOBHm_Chr4g0414561 RchiOBHm_Chr4g0414571 RchiOBHm_Chr7g0183021
rosa_laevigata	RLG00000005087
rosa_multiflora	Rmu_co8299331.1_g000001 Rmu_sc0000808.1_g000022 Rmu_sc0001063.1_g000013 Rmu_sc0005196.1_g000002
rosa_roxburghii	Rroxscaffold_3G00240320 Rroxscaffold_3G00240450 Rroxscaffold_3G00270840
rosa_rugosa	Rorug06G0451800
rosa_samantha	Rh4AG186600 Rh4AG186700 Rh4BG173800 Rh4BG184200 Rh4CG197200 Rh4CG197500 Rh4DG181800 Rh4DG181900 Rh4DG183300 Rh7AG055300 Rh7AG324400 Rh7BG054700 Rh7BG309400 Rh7CG056000 Rh7CG341300 Rh7DG054800
rosa_wichuraiana	Rw4G015750 Rw7G027480 Rw7G028300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	47
AcsI	RAATTY	2 cut(s)	172, 320
AcuI	CTGAAG	1 cut(s)	278
AfiI	CCNNNNNNNGG	1 cut(s)	15
AgsI	TTSAA	1 cut(s)	83
AluBI	AGCT	1 cut(s)	241
AluI	AGCT	1 cut(s)	241
Alw26I	GTCTC	1 cut(s)	128
AlwI	GGATC	1 cut(s)	47
AoxI	GGCC	1 cut(s)	18
ApeKI	GCWGC	1 cut(s)	241
ApoI	RAATTY	2 cut(s)	172, 320
ArsI	GACNNNNNNTTYG	2 cut(s)	127, 159
AspS9I	GGNCC	1 cut(s)	18
BbvI	GCAGC	1 cut(s)	228
BccI	CCATC	1 cut(s)	191
BciVI	GTATCC	1 cut(s)	157
BcoDI	GTCTC	1 cut(s)	128
BfuI	GTATCC	1 cut(s)	157
BisI	GCNGC	1 cut(s)	242
BlsI	GCNGC	1 cut(s)	243
BmgT120I	GGNCC	1 cut(s)	18
BmiI	GGNNCC	1 cut(s)	264
BmsI	GCATC	2 cut(s)	196, 299
BsaI	GGTCTC	1 cut(s)	128
BsaJI	CCNNGG	1 cut(s)	294
Bsc4I	CCNNNNNNNGG	1 cut(s)	15
Bse3DI	GCAATG	1 cut(s)	117
BseDI	CCNNGG	1 cut(s)	294
BseGI	GGATG	3 cut(s)	211, 283, 290
BseLI	CCNNNNNNNGG	1 cut(s)	15
BseMI	GCAATG	1 cut(s)	117
BseXI	GCAGC	1 cut(s)	228
BshFI	GGCC	1 cut(s)	20
BslI	CCNNNNNNNGG	1 cut(s)	15
BsmAI	GTCTC	1 cut(s)	128
BsmI	GAATGC	1 cut(s)	283
BsnI	GGCC	1 cut(s)	20
Bso31I	GGTCTC	1 cut(s)	128
Bsp143I	GATC	3 cut(s)	52, 76, 125
BspANI	GGCC	1 cut(s)	20
BspHI	TCATGA	1 cut(s)	270
BspLI	GGNNCC	1 cut(s)	264
BspPI	GGATC	1 cut(s)	47
BspTNI	GGTCTC	1 cut(s)	128
BsrDI	GCAATG	1 cut(s)	117
BssECI	CCNNGG	1 cut(s)	294
BssMI	GATC	3 cut(s)	52, 76, 125
BstC8I	GCNNGC	1 cut(s)	312
BstDEI	CTNAG	1 cut(s)	32
BstF5I	GGATG	3 cut(s)	211, 283, 290
BstKTI	GATC	3 cut(s)	55, 79, 128
BstMAI	GTCTC	1 cut(s)	128
BstMBI	GATC	3 cut(s)	52, 76, 125
BstMWI	GCNNNNNNNGC	1 cut(s)	262
BstNSI	RCATGY	1 cut(s)	314
BstV1I	GCAGC	1 cut(s)	228
BsuI	GTATCC	1 cut(s)	157
BsuRI	GGCC	1 cut(s)	20
BtsCI	GGATG	3 cut(s)	211, 283, 290
BtsIMutI	CAGTG	1 cut(s)	183
Cac8I	GCNNGC	1 cut(s)	312
CciI	TCATGA	1 cut(s)	270
Cfr13I	GGNCC	1 cut(s)	18
CviAII	CATG	3 cut(s)	160, 271, 311
CviJI	RGCY	4 cut(s)	20, 50, 241, 265
CviKI_1	RGCY	4 cut(s)	20, 50, 241, 265
DdeI	CTNAG	1 cut(s)	32
DpnI	GATC	3 cut(s)	54, 78, 127
DpnII	GATC	3 cut(s)	52, 76, 125
Eco31I	GGTCTC	1 cut(s)	128
Eco57I	CTGAAG	1 cut(s)	278
FaeI	CATG	3 cut(s)	163, 274, 314
FaiI	YATR	3 cut(s)	161, 272, 312
FatI	CATG	3 cut(s)	159, 270, 310
Fnu4HI	GCNGC	1 cut(s)	242
FokI	GGATG	3 cut(s)	218, 277, 290
Fsp4HI	GCNGC	1 cut(s)	242
GluI	GCNGC	1 cut(s)	242
HaeIII	GGCC	1 cut(s)	20
Hin1II	CATG	3 cut(s)	163, 274, 314
Hpy188I	TCNGA	2 cut(s)	62, 298
Hpy188III	TCNNGA	4 cut(s)	74, 83, 129, 271
HpyAV	CCTTC	4 cut(s)	67, 253, 268, 323
HpyCH4V	TGCA	4 cut(s)	244, 290, 310, 314
HpyF10VI	GCNNNNNNNGC	1 cut(s)	262
HpyF3I	CTNAG	1 cut(s)	32
Hsp92II	CATG	3 cut(s)	163, 274, 314
Kzo9I	GATC	3 cut(s)	52, 76, 125
LmnI	GCTCC	1 cut(s)	262
LpnPI	CCDG	3 cut(s)	87, 120, 136
Lsp1109I	GCAGC	1 cut(s)	228
LweI	GCATC	2 cut(s)	196, 299
MalI	GATC	3 cut(s)	54, 78, 127
MboI	GATC	3 cut(s)	52, 76, 125
MboII	GAAGA	1 cut(s)	71
MluCI	AATT	3 cut(s)	22, 172, 320
MmeI	TCCRAC	2 cut(s)	70, 132
MnlI	CCTC	5 cut(s)	15, 58, 148, 177, 304
MslI	CAYNNNNRTG	1 cut(s)	315
MspA1I	CMGCKG	1 cut(s)	241
Mva1269I	GAATGC	1 cut(s)	283
MwoI	GCNNNNNNNGC	1 cut(s)	262
NdeII	GATC	3 cut(s)	52, 76, 125
NlaIII	CATG	3 cut(s)	163, 274, 314
NlaIV	GGNNCC	1 cut(s)	264
NspI	RCATGY	1 cut(s)	314
PaeI	GCATGC	1 cut(s)	314
PagI	TCATGA	1 cut(s)	270
PctI	GAATGC	1 cut(s)	283
PkrI	GCNGC	1 cut(s)	243
PspN4I	GGNNCC	1 cut(s)	264
PspPI	GGNCC	1 cut(s)	18
PvuII	CAGCTG	1 cut(s)	241
RseI	CAYNNNNRTG	1 cut(s)	315
SatI	GCNGC	1 cut(s)	242
Sau3AI	GATC	3 cut(s)	52, 76, 125
Sau96I	GGNCC	1 cut(s)	18
SetI	ASST	2 cut(s)	159, 243
SfaNI	GCATC	2 cut(s)	196, 299
SmiMI	CAYNNNNRTG	1 cut(s)	315
SphI	GCATGC	1 cut(s)	314
Sse9I	AATT	3 cut(s)	22, 172, 320
TasI	AATT	3 cut(s)	22, 172, 320
TscAI	CASTG	1 cut(s)	183
TseI	GCWGC	1 cut(s)	241
TspDTI	ATGAA	1 cut(s)	287
TspRI	CASTG	1 cut(s)	183
XapI	RAATTY	2 cut(s)	172, 320
XceI	RCATGY	1 cut(s)	314

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.