Rmu_sc0000808.1_g000022

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000808.1
Physical Location & Seq
Forward (+)
94122 .. 94637
516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000808.1_g000022.1.cds

Sequence Viewer

Length: 516 bp
atgttagtattcattcttctaattttcagttattgcatgcgggttaatccctccttggttgaggactgggatccggacaattgggtctgcgaatcatctgaacagggcaatgagatgctttctccaaactctagtattaaggaagatacattaaagtcatcaactggtagaggccactatgatggcatgcattcagcagatcccagcagaaattgtaatggttcagggtggcaagctcactccaagaggcaaaagcttattgtgaatggaaaagttaagttcattacaaatgaagaagtcaggaggctatatttggcagacccgcctcagaagactcctgttgggtacaaaactattactccaaagtttcctgtttccggggttaaagcaaatcctagctttatacattcagaaattgcgatgcctcgtagacatggtaggccccccaagatgcaaagcatctcaaagattaatcagcaagctagcatgtcaaaatttaaaacattcacaaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

171

Amino Acids

19.36

Weight (kDa)

9.65

Isoelectric Point (pI)

56.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 83
AccI GTMKAC 1 cut(s) 430
AccIII TCCGGA 1 cut(s) 73
AciI CCGC 2 cut(s) 40, 323
AclWI GGATC 3 cut(s) 65, 78, 194
AcsI RAATTY 1 cut(s) 494
AdeI CACNNNGTG 1 cut(s) 513
AfaI GTAC 1 cut(s) 347
AfiI CCNNNNNNNGG 1 cut(s) 377
AluBI AGCT 4 cut(s) 236, 256, 399, 482
AluI AGCT 4 cut(s) 236, 256, 399, 482
AlwI GGATC 3 cut(s) 65, 78, 194
Aor13HI TCCGGA 1 cut(s) 73
AoxI GGCC 2 cut(s) 172, 440
ApoI RAATTY 1 cut(s) 494
AseI ATTAAT 1 cut(s) 471
AspS9I GGNCC 1 cut(s) 441
AsuC2I CCSGG 1 cut(s) 379
AsuNHI GCTAGC 1 cut(s) 482
BamHI GGATCC 1 cut(s) 70
BarI GAAGNNNNNNTAC 1 cut(s) 32
BbsI GAAGAC 1 cut(s) 338
BccI CCATC 1 cut(s) 176
BcnI CCSGG 1 cut(s) 379
BfaI CTAG 3 cut(s) 132, 396, 483
Bme1390I CCNGG 1 cut(s) 379
BmgT120I GGNCC 1 cut(s) 441
BmiI GGNNCC 2 cut(s) 72, 443
BmrFI CCNGG 1 cut(s) 379
BmrI ACTGGG 1 cut(s) 76
BmsI GCATC 4 cut(s) 105, 411, 441, 468
BmtI GCTAGC 1 cut(s) 486
BmuI ACTGGG 1 cut(s) 76
BpiI GAAGAC 1 cut(s) 338
BpuMI CCSGG 1 cut(s) 379
BsaJI CCNNGG 2 cut(s) 54, 378
BsaWI WCCGGW 1 cut(s) 73
BsaXI ACNNNNNCTCC 2 cut(s) 343, 373
Bsc4I CCNNNNNNNGG 1 cut(s) 377
Bse1I ACTGG 2 cut(s) 71, 169
Bse3DI GCAATG 1 cut(s) 115
BseAI TCCGGA 1 cut(s) 73
BseDI CCNNGG 2 cut(s) 54, 378
BseLI CCNNNNNNNGG 1 cut(s) 377
BseMI GCAATG 1 cut(s) 115
BseMII CTCAG 1 cut(s) 341
BseNI ACTGG 2 cut(s) 71, 169
BseYI CCCAGC 1 cut(s) 203
BshFI GGCC 2 cut(s) 174, 442
BsiSI CCGG 2 cut(s) 74, 378
BslI CCNNNNNNNGG 1 cut(s) 377
BsmI GAATGC 1 cut(s) 190
BsnI GGCC 2 cut(s) 174, 442
Bsp13I TCCGGA 1 cut(s) 73
Bsp143I GATC 2 cut(s) 70, 199
BspACI CCGC 2 cut(s) 40, 323
BspANI GGCC 2 cut(s) 174, 442
BspCNI CTCAG 1 cut(s) 340
BspEI TCCGGA 1 cut(s) 73
BspLI GGNNCC 2 cut(s) 72, 443
BspOI GCTAGC 1 cut(s) 486
BspPI GGATC 3 cut(s) 65, 78, 194
BsrDI GCAATG 1 cut(s) 115
BsrI ACTGG 2 cut(s) 71, 169
BssECI CCNNGG 2 cut(s) 54, 378
BssMI GATC 2 cut(s) 70, 199
BssT1I CCWWGG 1 cut(s) 54
BstC8I GCNNGC 5 cut(s) 38, 188, 234, 480, 484
BstDEI CTNAG 1 cut(s) 327
BstKTI GATC 2 cut(s) 73, 202
BstMBI GATC 2 cut(s) 70, 199
BstNSI RCATGY 3 cut(s) 40, 190, 490
BstSCI CCNGG 1 cut(s) 377
BstV2I GAAGAC 1 cut(s) 338
BstX2I RGATCY 2 cut(s) 70, 199
BstXI CCANNNNNNTGG 1 cut(s) 182
BstYI RGATCY 2 cut(s) 70, 199
BsuRI GGCC 2 cut(s) 174, 442
BtgZI GCGATG 1 cut(s) 434
Cac8I GCNNGC 5 cut(s) 38, 188, 234, 480, 484
Cfr13I GGNCC 1 cut(s) 441
Csp6I GTAC 1 cut(s) 346
CviAII CATG 4 cut(s) 37, 187, 434, 487
CviJI RGCY 7 cut(s) 174, 236, 256, 307, 399, 442, 482
CviKI_1 RGCY 7 cut(s) 174, 236, 256, 307, 399, 442, 482
CviQI GTAC 1 cut(s) 346
DdeI CTNAG 1 cut(s) 327
DpnI GATC 2 cut(s) 72, 201
DpnII GATC 2 cut(s) 70, 199
DraI TTTAAA 1 cut(s) 499
DraIII CACNNNGTG 1 cut(s) 513
DrdI GACNNNNNNGTC 1 cut(s) 83
DseDI GACNNNNNNGTC 1 cut(s) 83
Eco130I CCWWGG 1 cut(s) 54
EcoO109I RGGNCCY 1 cut(s) 441
EcoT14I CCWWGG 1 cut(s) 54
EcoT22I ATGCAT 1 cut(s) 192
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 4 cut(s) 40, 190, 437, 490
FaiI YATR 7 cut(s) 38, 180, 188, 310, 404, 435, 488
FatI CATG 4 cut(s) 36, 186, 433, 486
FauI CCCGC 2 cut(s) 33, 330
FblI GTMKAC 1 cut(s) 430
FspBI CTAG 3 cut(s) 132, 396, 483
GsaI CCCAGC 1 cut(s) 207
HaeIII GGCC 2 cut(s) 174, 442
HapII CCGG 2 cut(s) 74, 378
Hin1II CATG 4 cut(s) 40, 190, 437, 490
HindIII AAGCTT 1 cut(s) 254
HinfI GANTC 2 cut(s) 92, 334
HpaII CCGG 2 cut(s) 74, 378
Hpy166II GTNNAC 1 cut(s) 431
Hpy188I TCNGA 3 cut(s) 100, 330, 412
Hpy188III TCNNGA 2 cut(s) 74, 301
Hpy8I GTNNAC 1 cut(s) 431
HpyCH4V TGCA 3 cut(s) 36, 190, 454
HpyF3I CTNAG 1 cut(s) 327
Hsp92II CATG 4 cut(s) 40, 190, 437, 490
Kpn2I TCCGGA 1 cut(s) 73
Kzo9I GATC 2 cut(s) 70, 199
LweI GCATC 4 cut(s) 105, 411, 441, 468
MaeI CTAG 3 cut(s) 132, 396, 483
MalI GATC 2 cut(s) 72, 201
MboI GATC 2 cut(s) 70, 199
MboII GAAGA 4 cut(s) 8, 155, 305, 343
MfeI CAATTG 1 cut(s) 79
MflI RGATCY 2 cut(s) 70, 199
MluCI AATT 5 cut(s) 21, 79, 211, 414, 494
MlyI GAGTC 1 cut(s) 328
MnlI CCTC 7 cut(s) 55, 61, 164, 240, 297, 336, 435
Mph1103I ATGCAT 1 cut(s) 192
MroI TCCGGA 1 cut(s) 73
MseI TTAA 7 cut(s) 45, 138, 152, 276, 384, 471, 498
MslI CAYNNNNRTG 1 cut(s) 180
MspI CCGG 2 cut(s) 74, 378
MspR9I CCNGG 1 cut(s) 379
MunI CAATTG 1 cut(s) 79
Mva1269I GAATGC 1 cut(s) 190
NciI CCSGG 1 cut(s) 379
NdeII GATC 2 cut(s) 70, 199
NheI GCTAGC 1 cut(s) 482
NlaIII CATG 4 cut(s) 40, 190, 437, 490
NlaIV GGNNCC 2 cut(s) 72, 443
NsiI ATGCAT 1 cut(s) 192
NspI RCATGY 3 cut(s) 40, 190, 490
PaeI GCATGC 2 cut(s) 40, 190
PctI GAATGC 1 cut(s) 190
PfeI GAWTC 1 cut(s) 92
PleI GAGTC 1 cut(s) 328
PpsI GAGTC 1 cut(s) 328
PshBI ATTAAT 1 cut(s) 471
PspFI CCCAGC 1 cut(s) 203
PspN4I GGNNCC 2 cut(s) 72, 443
PspPI GGNCC 1 cut(s) 441
PsuI RGATCY 2 cut(s) 70, 199
RsaI GTAC 1 cut(s) 347
RsaNI GTAC 1 cut(s) 346
RseI CAYNNNNRTG 1 cut(s) 180
SaqAI TTAA 7 cut(s) 45, 138, 152, 276, 384, 471, 498
Sau3AI GATC 2 cut(s) 70, 199
Sau96I GGNCC 1 cut(s) 441
SchI GAGTC 1 cut(s) 328
ScrFI CCNGG 1 cut(s) 379
SetI ASST 5 cut(s) 238, 258, 401, 484, 515
SfaNI GCATC 4 cut(s) 105, 411, 441, 468
SmiMI CAYNNNNRTG 1 cut(s) 180
SphI GCATGC 2 cut(s) 40, 190
Sse9I AATT 5 cut(s) 21, 79, 211, 414, 494
SsiI CCGC 2 cut(s) 40, 323
SspMI CTAG 3 cut(s) 132, 396, 483
StyD4I CCNGG 1 cut(s) 377
StyI CCWWGG 1 cut(s) 54
TasI AATT 5 cut(s) 21, 79, 211, 414, 494
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 7 cut(s) 45, 138, 152, 276, 384, 471, 498
Tru9I TTAA 7 cut(s) 45, 138, 152, 276, 384, 471, 498
TspDTI ATGAA 2 cut(s) 271, 306
VspI ATTAAT 1 cut(s) 471
XapI RAATTY 1 cut(s) 494
XceI RCATGY 3 cut(s) 40, 190, 490
XmiI GTMKAC 1 cut(s) 430
XspI CTAG 3 cut(s) 132, 396, 483
Zsp2I ATGCAT 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.