RchiOBHm_Chr7g0179191

Glycosyltransferase-like domain-containing protein 2-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001096
Physical Location & Seq
Forward (+)
1570858 .. 1571250
393 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15971

Sequence Viewer

Length: 393 bp
ATGAGGGATACACGAAAATGGTCAGTGCAACAAGTAACTAGTTTCCAGGAAATGCCTCAATGTACACGAAATCACACTGTTCCAGGCATCTTGTTTTCAACTGGAGGATATACAGGAAACCATTTCCATGAATTTGCTGATGTGGTTATTCCGCTCTATATTAATTCTCAAAAATATGATGGAGAAGTTCAATTTCTTATCACTGACAAACGATCTTGGTGGATTACAAAGGACAAAGCAGTACTACAAGGACCATCCAAGTATGAGGCTATTAACATTGATGAAGATGTAGTCCATTGCTTCCCAATCACAACAGTTGGCCTTAAACGACATCCCAAGGATCTGATCCTTGATCCTTCACTATATTCCTATTCTATGAAAGAGATTTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00514 ko00515 ko01100 map00514 map00515 map01100
Pfam Domains
Protein Families
DUF563

Protein Analysis

130

Amino Acids

15.02

Weight (kDa)

6.5

Isoelectric Point (pI)

38.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 154
AciI CCGC 1 cut(s) 152
AclWI GGATC 3 cut(s) 340, 347, 348
AcsI RAATTY 1 cut(s) 131
AfaI GTAC 2 cut(s) 64, 243
AgsI TTSAA 2 cut(s) 99, 191
AhlI ACTAGT 1 cut(s) 38
AjnI CCWGG 2 cut(s) 45, 82
AlwI GGATC 3 cut(s) 340, 347, 348
AoxI GGCC 1 cut(s) 319
ApoI RAATTY 1 cut(s) 131
AseI ATTAAT 1 cut(s) 162
AspS9I GGNCC 1 cut(s) 251
AvaII GGWCC 1 cut(s) 251
BccI CCATC 2 cut(s) 173, 262
BciT130I CCWGG 2 cut(s) 47, 84
BcuI ACTAGT 1 cut(s) 38
BfaI CTAG 2 cut(s) 39, 391
BmcAI AGTACT 1 cut(s) 243
Bme1390I CCNGG 2 cut(s) 47, 84
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 251
BmrFI CCNGG 2 cut(s) 47, 84
BmsI GCATC 1 cut(s) 96
BpmI CTGGAG 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 336
Bse1I ACTGG 1 cut(s) 106
Bse3DI GCAATG 1 cut(s) 295
BseBI CCWGG 2 cut(s) 47, 84
BseDI CCNNGG 1 cut(s) 336
BseGI GGATG 2 cut(s) 254, 331
BseMI GCAATG 1 cut(s) 295
BseNI ACTGG 1 cut(s) 106
BshFI GGCC 1 cut(s) 321
BsnI GGCC 1 cut(s) 321
Bsp1407I TGTACA 1 cut(s) 62
Bsp143I GATC 4 cut(s) 212, 340, 345, 352
BspACI CCGC 1 cut(s) 152
BspANI GGCC 1 cut(s) 321
BspPI GGATC 3 cut(s) 340, 347, 348
BsrBI CCGCTC 1 cut(s) 154
BsrDI GCAATG 1 cut(s) 295
BsrGI TGTACA 1 cut(s) 62
BsrI ACTGG 1 cut(s) 106
BssECI CCNNGG 1 cut(s) 336
BssMI GATC 4 cut(s) 212, 340, 345, 352
BssT1I CCWWGG 1 cut(s) 336
Bst2UI CCWGG 2 cut(s) 47, 84
Bst4CI ACNGT 2 cut(s) 79, 316
BstAUI TGTACA 1 cut(s) 62
BstF5I GGATG 2 cut(s) 254, 331
BstKTI GATC 4 cut(s) 215, 343, 348, 355
BstMBI GATC 4 cut(s) 212, 340, 345, 352
BstNI CCWGG 2 cut(s) 47, 84
BstSCI CCNGG 2 cut(s) 45, 82
BstX2I RGATCY 1 cut(s) 340
BstYI RGATCY 1 cut(s) 340
BsuRI GGCC 1 cut(s) 321
BtsCI GGATG 2 cut(s) 254, 331
BtsIMutI CAGTG 3 cut(s) 30, 75, 201
Cfr13I GGNCC 1 cut(s) 251
Csp6I GTAC 2 cut(s) 63, 242
CviAII CATG 1 cut(s) 128
CviJI RGCY 2 cut(s) 269, 321
CviKI_1 RGCY 2 cut(s) 269, 321
CviQI GTAC 2 cut(s) 63, 242
DpnI GATC 4 cut(s) 214, 342, 347, 354
DpnII GATC 4 cut(s) 212, 340, 345, 352
Eco130I CCWWGG 1 cut(s) 336
Eco47I GGWCC 1 cut(s) 251
EcoRII CCWGG 2 cut(s) 45, 82
EcoT14I CCWWGG 1 cut(s) 336
ErhI CCWWGG 1 cut(s) 336
FaeI CATG 1 cut(s) 131
FaiI YATR 7 cut(s) 111, 129, 159, 177, 264, 364, 377
FatI CATG 1 cut(s) 127
FokI GGATG 2 cut(s) 241, 318
FspBI CTAG 2 cut(s) 39, 391
GsuI CTGGAG 1 cut(s) 123
HaeIII GGCC 1 cut(s) 321
Hin1II CATG 1 cut(s) 131
Hpy166II GTNNAC 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 345
Hpy8I GTNNAC 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 366
HpyCH4III ACNGT 2 cut(s) 79, 316
HpyCH4V TGCA 1 cut(s) 28
Hsp92II CATG 1 cut(s) 131
Kzo9I GATC 4 cut(s) 212, 340, 345, 352
LpnPI CCDG 6 cut(s) 32, 59, 69, 87, 96, 99
LweI GCATC 1 cut(s) 96
MaeI CTAG 2 cut(s) 39, 391
MaeIII GTNAC 1 cut(s) 34
MalI GATC 4 cut(s) 214, 342, 347, 354
MbiI CCGCTC 1 cut(s) 154
MboI GATC 4 cut(s) 212, 340, 345, 352
MboII GAAGA 1 cut(s) 296
MflI RGATCY 1 cut(s) 340
MluCI AATT 3 cut(s) 131, 163, 191
MnlI CCTC 3 cut(s) 66, 98, 259
MseI TTAA 3 cut(s) 162, 273, 324
MslI CAYNNNNRTG 2 cut(s) 16, 126
MspR9I CCNGG 2 cut(s) 47, 84
MvaI CCWGG 2 cut(s) 47, 84
NdeII GATC 4 cut(s) 212, 340, 345, 352
NlaIII CATG 1 cut(s) 131
PfoI TCCNGGA 1 cut(s) 45
PshBI ATTAAT 1 cut(s) 162
Psp6I CCWGG 2 cut(s) 45, 82
PspGI CCWGG 2 cut(s) 45, 82
PspPI GGNCC 1 cut(s) 251
PsuI RGATCY 1 cut(s) 340
RsaI GTAC 2 cut(s) 64, 243
RsaNI GTAC 2 cut(s) 63, 242
RseI CAYNNNNRTG 2 cut(s) 16, 126
SaqAI TTAA 3 cut(s) 162, 273, 324
Sau3AI GATC 4 cut(s) 212, 340, 345, 352
Sau96I GGNCC 1 cut(s) 251
ScaI AGTACT 1 cut(s) 243
ScrFI CCNGG 2 cut(s) 47, 84
SfaNI GCATC 1 cut(s) 96
SinI GGWCC 1 cut(s) 251
SmiMI CAYNNNNRTG 2 cut(s) 16, 126
SpeI ACTAGT 1 cut(s) 38
Sse9I AATT 3 cut(s) 131, 163, 191
SsiI CCGC 1 cut(s) 152
SspMI CTAG 2 cut(s) 39, 391
StyD4I CCNGG 2 cut(s) 45, 82
StyI CCWWGG 1 cut(s) 336
TaaI ACNGT 2 cut(s) 79, 316
TasI AATT 3 cut(s) 131, 163, 191
TatI WGTACW 2 cut(s) 62, 241
Tru1I TTAA 3 cut(s) 162, 273, 324
Tru9I TTAA 3 cut(s) 162, 273, 324
TscAI CASTG 3 cut(s) 30, 82, 208
TspDTI ATGAA 3 cut(s) 144, 297, 392
TspRI CASTG 3 cut(s) 30, 82, 208
VpaK11BI GGWCC 1 cut(s) 251
VspI ATTAAT 1 cut(s) 162
XapI RAATTY 1 cut(s) 131
XspI CTAG 2 cut(s) 39, 391
ZrmI AGTACT 1 cut(s) 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.