RchiOBHm_Chr7g0183791

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0000810
Physical Location & Seq
Forward (+)
4554122 .. 4554906
785 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16399

Sequence Viewer

Length: 204 bp
ATGAAATGGCTTGCAAGAAAGCATGTGGCGTGGGAGCTAGAAGCACATGAGTTGCAAAAGATGAGAGATTTGCTACGGTGTAATCTACTGCACTTGAAAATGGTTTTGGATTGGAGGCTGGGAATGCTTGGCTTGTTGCTTGAGACTTGCTTGAAAGATGTATTGTCTAGAGGTTCTGAAGTTTGTTGCTTGGAGGTTGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.89

Weight (kDa)

7.71

Isoelectric Point (pI)

34.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 198
AgsI TTSAA 2 cut(s) 97, 154
AjuI GAANNNNNNNTTGG 2 cut(s) 89, 121
AluBI AGCT 1 cut(s) 37
AluI AGCT 1 cut(s) 37
Alw26I GTCTC 1 cut(s) 137
BcoDI GTCTC 1 cut(s) 137
BfaI CTAG 2 cut(s) 38, 168
BpuEI CTTGAG 1 cut(s) 161
BseYI CCCAGC 1 cut(s) 118
BsgI GTGCAG 1 cut(s) 74
BsmAI GTCTC 1 cut(s) 137
BsmI GAATGC 1 cut(s) 129
Bst4CI ACNGT 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 12
BstMAI GTCTC 1 cut(s) 137
BstMWI GCNNNNNNNGC 1 cut(s) 124
BstNSI RCATGY 1 cut(s) 26
Cac8I GCNNGC 1 cut(s) 12
CviAII CATG 2 cut(s) 23, 47
CviJI RGCY 4 cut(s) 10, 37, 118, 132
CviKI_1 RGCY 4 cut(s) 10, 37, 118, 132
Eco57I CTGAAG 1 cut(s) 198
FaeI CATG 2 cut(s) 26, 50
FaiI YATR 3 cut(s) 24, 48, 202
FatI CATG 2 cut(s) 22, 46
FspBI CTAG 2 cut(s) 38, 168
GsaI CCCAGC 1 cut(s) 122
Hin1II CATG 2 cut(s) 26, 50
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 1 cut(s) 168
HpyCH4III ACNGT 1 cut(s) 78
HpyCH4V TGCA 3 cut(s) 14, 55, 91
HpyF10VI GCNNNNNNNGC 1 cut(s) 124
Hsp92II CATG 2 cut(s) 26, 50
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 1 cut(s) 104
MaeI CTAG 2 cut(s) 38, 168
MnlI CCTC 3 cut(s) 108, 164, 187
Mva1269I GAATGC 1 cut(s) 129
MwoI GCNNNNNNNGC 1 cut(s) 124
NlaIII CATG 2 cut(s) 26, 50
NspI RCATGY 1 cut(s) 26
PctI GAATGC 1 cut(s) 129
PspFI CCCAGC 1 cut(s) 118
SetI ASST 3 cut(s) 39, 175, 198
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
SspMI CTAG 2 cut(s) 38, 168
TaaI ACNGT 1 cut(s) 78
TspDTI ATGAA 1 cut(s) 17
XbaI TCTAGA 1 cut(s) 167
XceI RCATGY 1 cut(s) 26
XspI CTAG 2 cut(s) 38, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.