Rmu_sc0001203.1_g000001

Ribosomal protein L35Ae

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001203.1
Physical Location & Seq
Reverse (-)
2 .. 758
757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001203.1_g000001.1.cds

Sequence Viewer

Length: 188 bp
cgctcgttcctgtggttacaggggtcatcattgccagtgggggtgaaccaagtttccatctatttgggttcttaatttgtatcgcagcaacagctgccagggcgcttaagtcagtgctacaagggattttactttcttctgaaggggagaagctgaattcgatgaacctcctattgtatatggctccg

Protein Analysis

62

Amino Acids

6.44

Weight (kDa)

6.75

Isoelectric Point (pI)

41.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 156
AcuI CTGAAG 1 cut(s) 161
AflII CTTAAG 1 cut(s) 106
AjnI CCWGG 1 cut(s) 97
AloI GAACNNNNNNTCC 2 cut(s) 38, 70
AluBI AGCT 2 cut(s) 94, 153
AluI AGCT 2 cut(s) 94, 153
ApeKI GCWGC 2 cut(s) 85, 94
ApoI RAATTY 1 cut(s) 156
AspLEI GCGC 1 cut(s) 105
AsuHPI GGTGA 1 cut(s) 55
BbvI GCAGC 2 cut(s) 81, 97
BccI CCATC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 99
BfoI RGCGCY 1 cut(s) 106
BfrI CTTAAG 1 cut(s) 106
BisI GCNGC 2 cut(s) 86, 95
BlsI GCNGC 2 cut(s) 87, 96
Bme1390I CCNGG 1 cut(s) 99
BmiI GGNNCC 1 cut(s) 185
BmrFI CCNGG 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 98
Bse1I ACTGG 1 cut(s) 35
Bse3DI GCAATG 1 cut(s) 29
BseBI CCWGG 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 98
BseMI GCAATG 1 cut(s) 29
BseNI ACTGG 1 cut(s) 35
BseXI GCAGC 2 cut(s) 81, 97
BspLI GGNNCC 1 cut(s) 185
BspTI CTTAAG 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 29
BsrI ACTGG 1 cut(s) 35
BssECI CCNNGG 1 cut(s) 98
Bst2UI CCWGG 1 cut(s) 99
BstAFI CTTAAG 1 cut(s) 106
BstAPI GCANNNNNTGC 1 cut(s) 94
BstH2I RGCGCY 1 cut(s) 106
BstHHI GCGC 1 cut(s) 105
BstMWI GCNNNNNNNGC 3 cut(s) 91, 94, 100
BstNI CCWGG 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 97
BstV1I GCAGC 2 cut(s) 81, 97
BstXI CCANNNNNNTGG 1 cut(s) 64
BtsIMutI CAGTG 2 cut(s) 42, 119
CfoI GCGC 1 cut(s) 105
CviJI RGCY 3 cut(s) 94, 153, 184
CviKI_1 RGCY 3 cut(s) 94, 153, 184
Eco57I CTGAAG 1 cut(s) 161
EcoRI GAATTC 1 cut(s) 156
EcoRII CCWGG 1 cut(s) 97
FaiI YATR 2 cut(s) 179, 181
Fnu4HI GCNGC 2 cut(s) 86, 95
Fsp4HI GCNGC 2 cut(s) 86, 95
GlaI GCGC 1 cut(s) 104
GluI GCNGC 2 cut(s) 86, 95
HaeII RGCGCY 1 cut(s) 106
HhaI GCGC 1 cut(s) 105
Hin6I GCGC 1 cut(s) 103
HinP1I GCGC 1 cut(s) 103
HphI GGTGA 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 141
Hpy8I GTNNAC 1 cut(s) 46
HpyAV CCTTC 1 cut(s) 136
HpyF10VI GCNNNNNNNGC 3 cut(s) 91, 94, 100
HspAI GCGC 1 cut(s) 103
LpnPI CCDG 5 cut(s) 5, 23, 48, 84, 111
Lsp1109I GCAGC 2 cut(s) 81, 97
MaeIII GTNAC 1 cut(s) 15
MboII GAAGA 1 cut(s) 128
MluCI AATT 2 cut(s) 74, 156
MnlI CCTC 1 cut(s) 178
MseI TTAA 2 cut(s) 73, 107
MspA1I CMGCKG 1 cut(s) 94
MspCI CTTAAG 1 cut(s) 106
MspR9I CCNGG 1 cut(s) 99
MvaI CCWGG 1 cut(s) 99
MwoI GCNNNNNNNGC 3 cut(s) 91, 94, 100
NlaIV GGNNCC 1 cut(s) 185
PkrI GCNGC 2 cut(s) 87, 96
Psp6I CCWGG 1 cut(s) 97
PspGI CCWGG 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 185
PvuII CAGCTG 1 cut(s) 94
SaqAI TTAA 2 cut(s) 73, 107
SatI GCNGC 2 cut(s) 86, 95
ScrFI CCNGG 1 cut(s) 99
SetI ASST 3 cut(s) 96, 155, 170
SgeI CNNG 8 cut(s) 16, 22, 32, 47, 62, 110, 111, 133
SmlI CTYRAG 1 cut(s) 106
SmoI CTYRAG 1 cut(s) 106
Sse9I AATT 2 cut(s) 74, 156
StyD4I CCNGG 1 cut(s) 97
TaqI TCGA 1 cut(s) 160
TasI AATT 2 cut(s) 74, 156
Tru1I TTAA 2 cut(s) 73, 107
Tru9I TTAA 2 cut(s) 73, 107
TscAI CASTG 2 cut(s) 42, 119
TseI GCWGC 2 cut(s) 85, 94
TspDTI ATGAA 1 cut(s) 178
TspRI CASTG 2 cut(s) 42, 119
Vha464I CTTAAG 1 cut(s) 106
XapI RAATTY 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.