RLG00000005711

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Reverse (-)
1073264 .. 1073681
418 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000005711

Sequence Viewer

Length: 309 bp
ATGGAGAAGCTCAAACTAAAGCAAGGGATAAAAATTGCTATGAGCATTTATAGCAAGGGGAATGCATATCTCCAAGAATCCAAATTCTGGAAGCTCTACAAGGAGGACCGGCCTCCGTGCTCCATTGTCATCAAAACATCAGTAGGGCTAGTAGCAAAACGGCTTTGGGAGATTGTACCTGATGGTCACAAGATTGGGGAACCTGAGACATTGTTCACGATGTTGAAAGACGAAGAAGTCGAATCTCAAAGGAAGAAATGTGCTGGAAGCCAAGCTGACAGGAAAAAAACATACCCAATAAGCTTTTAG

Protein Analysis

103

Amino Acids

11.74

Weight (kDa)

9.46

Isoelectric Point (pI)

36.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 236
AccB7I CCANNNNNTGG 1 cut(s) 87
AcsI RAATTY 1 cut(s) 83
AfaI GTAC 1 cut(s) 177
AfiI CCNNNNNNNGG 1 cut(s) 87
AgsI TTSAA 1 cut(s) 226
AluBI AGCT 4 cut(s) 10, 94, 275, 303
AluI AGCT 4 cut(s) 10, 94, 275, 303
Alw21I GWGCWC 1 cut(s) 122
Alw26I GTCTC 1 cut(s) 200
AoxI GGCC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
Bbv12I GWGCWC 1 cut(s) 122
BccI CCATC 1 cut(s) 176
BceAI ACGGC 1 cut(s) 176
BcoDI GTCTC 1 cut(s) 200
BfaI CTAG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 201
Bsc4I CCNNNNNNNGG 1 cut(s) 87
Bse118I RCCGGY 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 195
BshFI GGCC 1 cut(s) 112
BsiHKAI GWGCWC 1 cut(s) 122
BsiSI CCGG 1 cut(s) 109
BslI CCNNNNNNNGG 1 cut(s) 87
BsmAI GTCTC 1 cut(s) 200
BsmI GAATGC 1 cut(s) 67
BsnI GGCC 1 cut(s) 112
Bsp1286I GDGCHC 1 cut(s) 122
BspANI GGCC 1 cut(s) 112
BspCNI CTCAG 1 cut(s) 196
BspLI GGNNCC 1 cut(s) 201
BsrFI RCCGGY 1 cut(s) 108
BssAI RCCGGY 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 204
BstMAI GTCTC 1 cut(s) 200
BstMWI GCNNNNNNNGC 1 cut(s) 51
BsuRI GGCC 1 cut(s) 112
Cfr10I RCCGGY 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 106
Csp6I GTAC 1 cut(s) 176
CviJI RGCY 8 cut(s) 10, 94, 112, 148, 163, 270, 275, 303
CviKI_1 RGCY 8 cut(s) 10, 94, 112, 148, 163, 270, 275, 303
CviQI GTAC 1 cut(s) 176
DdeI CTNAG 1 cut(s) 204
DrdI GACNNNNNNGTC 1 cut(s) 236
DseDI GACNNNNNNGTC 1 cut(s) 236
Eco47I GGWCC 1 cut(s) 106
EcoT22I ATGCAT 1 cut(s) 67
FaiI YATR 4 cut(s) 41, 51, 67, 292
FspBI CTAG 1 cut(s) 149
HaeIII GGCC 1 cut(s) 112
HapII CCGG 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 301
HinfI GANTC 2 cut(s) 77, 242
HpaII CCGG 1 cut(s) 109
Hpy166II GTNNAC 1 cut(s) 216
Hpy188III TCNNGA 2 cut(s) 88, 217
Hpy8I GTNNAC 1 cut(s) 216
HpyCH4V TGCA 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 51
HpyF3I CTNAG 1 cut(s) 204
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 6 cut(s) 73, 122, 192, 216, 249, 265
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 185
MboII GAAGA 2 cut(s) 245, 265
MhlI GDGCHC 1 cut(s) 122
MluCI AATT 2 cut(s) 33, 83
MnlI CCTC 2 cut(s) 97, 123
Mph1103I ATGCAT 1 cut(s) 67
MspI CCGG 1 cut(s) 109
Mva1269I GAATGC 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 51
NlaIV GGNNCC 1 cut(s) 201
NmuCI GTSAC 1 cut(s) 185
NsiI ATGCAT 1 cut(s) 67
PcsI WCGNNNNNNNCGW 1 cut(s) 237
PctI GAATGC 1 cut(s) 67
PfeI GAWTC 2 cut(s) 77, 242
PflMI CCANNNNNTGG 1 cut(s) 87
PspN4I GGNNCC 1 cut(s) 201
PspPI GGNCC 1 cut(s) 106
RsaI GTAC 1 cut(s) 177
RsaNI GTAC 1 cut(s) 176
Sau96I GGNCC 1 cut(s) 106
SduI GDGCHC 1 cut(s) 122
SetI ASST 6 cut(s) 12, 96, 181, 205, 277, 305
SinI GGWCC 1 cut(s) 106
Sse9I AATT 2 cut(s) 33, 83
SspMI CTAG 1 cut(s) 149
TaqI TCGA 1 cut(s) 240
TasI AATT 2 cut(s) 33, 83
TfiI GAWTC 2 cut(s) 77, 242
TseFI GTSAC 1 cut(s) 185
Tsp45I GTSAC 1 cut(s) 185
TspGWI ACGGA 1 cut(s) 105
Van91I CCANNNNNTGG 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 1 cut(s) 83
XspI CTAG 1 cut(s) 149
Zsp2I ATGCAT 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.