Rmu_co8047734.1_g000001

expansin-A23-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8047734.1
Physical Location & Seq
Forward (+)
42 .. 551
510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8047734.1_g000001.1.cds

Sequence Viewer

Length: 510 bp
atgtgtgtcaacgatccacagtggtgcaaacctaacgcagttatcaaagtcactgcaacaaatttctgtccaccaaattgggttccagctcctgatcattggtgcaacccacctcgcaaacactttgacttgtccatggctatgttcacaaaacttgcagaatacaaagccggtatcattccagttatatatcgccgaaccccatgtgacagaaatggagggattaagtttgaggttaagggaaacccctactggacttctgttgtggtttataatgttgctggtgctggtcttgttaaccacgtcgcaattaaggggtccaactccggttggatttcaatgacgcgcaattggggccaagtttggcagaccggagtcaaattagtagggcaaggcttatcattccgggtcactgctggagatggggaagtgctttggttagataatgttgcaccagcgaattggcaattcggtcaaacctacgagggacacggcaattttataggctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

169

Amino Acids

18.75

Weight (kDa)

9.04

Isoelectric Point (pI)

7.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 273
AccII CGCG 1 cut(s) 346
AclWI GGATC 1 cut(s) 8
AcsI RAATTY 1 cut(s) 61
AgsI TTSAA 1 cut(s) 339
AjiI CACGTC 1 cut(s) 304
AleI CACNNNNGTG 1 cut(s) 22
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AlwI GGATC 1 cut(s) 8
AlwNI CAGNNNCTG 1 cut(s) 92
AoxI GGCC 1 cut(s) 355
ApoI RAATTY 1 cut(s) 61
AspLEI GCGC 1 cut(s) 348
AspS9I GGNCC 2 cut(s) 318, 355
AsuC2I CCSGG 1 cut(s) 407
AvaII GGWCC 1 cut(s) 318
BccI CCATC 1 cut(s) 416
BceAI ACGGC 1 cut(s) 508
BclI TGATCA 1 cut(s) 94
BcnI CCSGG 1 cut(s) 407
Bme1390I CCNGG 1 cut(s) 407
Bme18I GGWCC 1 cut(s) 318
BmgBI CACGTC 1 cut(s) 304
BmgT120I GGNCC 2 cut(s) 318, 355
BmiI GGNNCC 3 cut(s) 84, 319, 356
BmrFI CCNGG 1 cut(s) 407
BoxI GACNNNNGTC 1 cut(s) 374
BpmI CTGGAG 1 cut(s) 438
BpuMI CCSGG 1 cut(s) 407
BsaJI CCNNGG 1 cut(s) 135
BsaWI WCCGGW 2 cut(s) 326, 371
Bse118I RCCGGY 1 cut(s) 170
Bse1I ACTGG 2 cut(s) 182, 257
BseDI CCNNGG 1 cut(s) 135
BseNI ACTGG 2 cut(s) 182, 257
Bsh1236I CGCG 1 cut(s) 346
BshFI GGCC 1 cut(s) 357
BsiSI CCGG 4 cut(s) 171, 327, 372, 406
BslFI GGGAC 1 cut(s) 501
BsmFI GGGAC 1 cut(s) 501
BsnI GGCC 1 cut(s) 357
Bsp143I GATC 2 cut(s) 13, 94
Bsp19I CCATGG 1 cut(s) 135
BspANI GGCC 1 cut(s) 357
BspFNI CGCG 1 cut(s) 346
BspLI GGNNCC 3 cut(s) 84, 319, 356
BspPI GGATC 1 cut(s) 8
BsrFI RCCGGY 1 cut(s) 170
BsrI ACTGG 2 cut(s) 182, 257
BssAI RCCGGY 1 cut(s) 170
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 2 cut(s) 13, 94
BssT1I CCWWGG 1 cut(s) 135
Bst4CI ACNGT 1 cut(s) 21
BstDSI CCRYGG 1 cut(s) 135
BstFNI CGCG 1 cut(s) 346
BstHHI GCGC 1 cut(s) 348
BstKTI GATC 2 cut(s) 16, 97
BstMBI GATC 2 cut(s) 13, 94
BstMWI GCNNNNNNNGC 1 cut(s) 354
BstPAI GACNNNNGTC 1 cut(s) 374
BstSCI CCNGG 1 cut(s) 405
BstUI CGCG 1 cut(s) 346
BstXI CCANNNNNNTGG 2 cut(s) 78, 462
BsuRI GGCC 1 cut(s) 357
BtgI CCRYGG 1 cut(s) 135
BtrI CACGTC 1 cut(s) 304
BtsI GCAGTG 2 cut(s) 51, 411
BtsIMutI CAGTG 3 cut(s) 26, 51, 411
CaiI CAGNNNCTG 1 cut(s) 92
CfoI GCGC 1 cut(s) 348
Cfr10I RCCGGY 1 cut(s) 170
Cfr13I GGNCC 2 cut(s) 318, 355
CseI GACGC 1 cut(s) 352
CviAII CATG 2 cut(s) 136, 204
CviJI RGCY 6 cut(s) 89, 140, 170, 357, 396, 507
CviKI_1 RGCY 6 cut(s) 89, 140, 170, 357, 396, 507
DpnI GATC 2 cut(s) 15, 96
DpnII GATC 2 cut(s) 13, 94
Eco130I CCWWGG 1 cut(s) 135
Eco47I GGWCC 1 cut(s) 318
EcoT14I CCWWGG 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 135
FaeI CATG 2 cut(s) 139, 207
FaiI YATR 7 cut(s) 137, 143, 188, 190, 205, 273, 503
FaqI GGGAC 1 cut(s) 501
FatI CATG 2 cut(s) 135, 203
FbaI TGATCA 1 cut(s) 94
GlaI GCGC 1 cut(s) 347
GsuI CTGGAG 1 cut(s) 438
HaeIII GGCC 1 cut(s) 357
HapII CCGG 4 cut(s) 171, 327, 372, 406
HgaI GACGC 1 cut(s) 352
HhaI GCGC 1 cut(s) 348
Hin1II CATG 2 cut(s) 139, 207
Hin6I GCGC 1 cut(s) 346
HinP1I GCGC 1 cut(s) 346
HincII GTYRAC 2 cut(s) 10, 298
HindII GTYRAC 2 cut(s) 10, 298
HinfI GANTC 1 cut(s) 375
HpaI GTTAAC 1 cut(s) 298
HpaII CCGG 4 cut(s) 171, 327, 372, 406
Hpy166II GTNNAC 4 cut(s) 10, 71, 147, 298
Hpy188III TCNNGA 1 cut(s) 92
Hpy8I GTNNAC 4 cut(s) 10, 71, 147, 298
Hpy99I CGWCG 1 cut(s) 308
HpyCH4III ACNGT 1 cut(s) 21
HpyCH4IV ACGT 1 cut(s) 303
HpyCH4V TGCA 5 cut(s) 27, 56, 105, 158, 452
HpyF10VI GCNNNNNNNGC 1 cut(s) 354
HpySE526I ACGT 1 cut(s) 303
Hsp92II CATG 2 cut(s) 139, 207
HspAI GCGC 1 cut(s) 346
Ksp22I TGATCA 1 cut(s) 94
KspAI GTTAAC 1 cut(s) 298
Kzo9I GATC 2 cut(s) 13, 94
LmnI GCTCC 1 cut(s) 94
MaeII ACGT 1 cut(s) 303
MaeIII GTNAC 3 cut(s) 49, 206, 409
MalI GATC 2 cut(s) 15, 96
MboI GATC 2 cut(s) 13, 94
MfeI CAATTG 1 cut(s) 349
MluCI AATT 8 cut(s) 61, 76, 309, 349, 380, 460, 467, 496
MlyI GAGTC 1 cut(s) 384
MmeI TCCRAC 2 cut(s) 311, 345
MnlI CCTC 4 cut(s) 123, 212, 226, 478
MseI TTAA 4 cut(s) 225, 237, 297, 312
MslI CAYNNNNRTG 2 cut(s) 22, 140
MspI CCGG 4 cut(s) 171, 327, 372, 406
MspR9I CCNGG 1 cut(s) 407
MunI CAATTG 1 cut(s) 349
MvnI CGCG 1 cut(s) 346
MwoI GCNNNNNNNGC 1 cut(s) 354
NciI CCSGG 1 cut(s) 407
NcoI CCATGG 1 cut(s) 135
NdeII GATC 2 cut(s) 13, 94
NlaIII CATG 2 cut(s) 139, 207
NlaIV GGNNCC 3 cut(s) 84, 319, 356
NmuCI GTSAC 3 cut(s) 49, 206, 409
OliI CACNNNNGTG 1 cut(s) 22
PleI GAGTC 1 cut(s) 383
PpsI GAGTC 1 cut(s) 383
PshAI GACNNNNGTC 1 cut(s) 374
PsiI TTATAA 1 cut(s) 273
PspN4I GGNNCC 3 cut(s) 84, 319, 356
PspPI GGNCC 2 cut(s) 318, 355
PstNI CAGNNNCTG 1 cut(s) 92
RseI CAYNNNNRTG 2 cut(s) 22, 140
SaqAI TTAA 4 cut(s) 225, 237, 297, 312
Sau3AI GATC 2 cut(s) 13, 94
Sau96I GGNCC 2 cut(s) 318, 355
SchI GAGTC 1 cut(s) 384
ScrFI CCNGG 1 cut(s) 407
SetI ASST 6 cut(s) 34, 91, 115, 237, 306, 482
SinI GGWCC 1 cut(s) 318
SmiMI CAYNNNNRTG 2 cut(s) 22, 140
Sse9I AATT 8 cut(s) 61, 76, 309, 349, 380, 460, 467, 496
StyD4I CCNGG 1 cut(s) 405
StyI CCWWGG 1 cut(s) 135
TaaI ACNGT 1 cut(s) 21
TaiI ACGT 1 cut(s) 306
TaqII GACCGA 1 cut(s) 461
TasI AATT 8 cut(s) 61, 76, 309, 349, 380, 460, 467, 496
Tru1I TTAA 4 cut(s) 225, 237, 297, 312
Tru9I TTAA 4 cut(s) 225, 237, 297, 312
TscAI CASTG 3 cut(s) 26, 58, 418
TseFI GTSAC 3 cut(s) 49, 206, 409
Tsp45I GTSAC 3 cut(s) 49, 206, 409
TspRI CASTG 3 cut(s) 26, 58, 418
VpaK11BI GGWCC 1 cut(s) 318
XapI RAATTY 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.