Rmu_sc0000260.1_g000020

Plastocyanin-like domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000260.1
Physical Location & Seq
Reverse (-)
76231 .. 76857
627 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000260.1_g000020.1.cds

Sequence Viewer

Length: 513 bp
atgaaggtgaatgttgtgatcttggtccttgttatggcattggcagtggtaatgttacgtggaacagaagctgcaaaatacagagttggagggaacttgggttggactatccctcccggcggtgctgccacttatgctgcatgggcgaagtacaccttcaaagttgacaaggatcttatagcattggcagcagcaatgttaagtgcaacagaagctagaaagtatacagtcggaggtgacttgggttggactatccctcccagcggcgctgccacttatgcttcatgggcttcaaagtacaccttcaaagttgacaaggatcttctagggttcgacttcaaagcagtaaaaaatgacgtgattgtagtcacaaaggagaatttcgacatctgcaacaccacgaaaccattatatcaatacaagggtccagtatttcttagagctgctgttggtgcagaaaattccgttgaggagtttgactcaccaattaatgcggactggagcgggaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

170

Amino Acids

18.35

Weight (kDa)

8.56

Isoelectric Point (pI)

13.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 504
AccI GTMKAC 1 cut(s) 224
AciI CCGC 4 cut(s) 120, 264, 494, 504
AclWI GGATC 2 cut(s) 180, 327
AcsI RAATTY 2 cut(s) 379, 460
AfaI GTAC 2 cut(s) 152, 299
AfiI CCNNNNNNNGG 3 cut(s) 34, 119, 263
AgsI TTSAA 4 cut(s) 160, 294, 307, 340
AjiI CACGTC 1 cut(s) 358
AluBI AGCT 3 cut(s) 71, 215, 443
AluI AGCT 3 cut(s) 71, 215, 443
AlwI GGATC 2 cut(s) 180, 327
AlwNI CAGNNNCTG 1 cut(s) 71
ApeKI GCWGC 7 cut(s) 71, 125, 137, 188, 191, 269, 443
ApoI RAATTY 2 cut(s) 379, 460
AseI ATTAAT 1 cut(s) 489
AspLEI GCGC 1 cut(s) 269
AspS9I GGNCC 2 cut(s) 25, 425
AsuC2I CCSGG 1 cut(s) 117
AsuHPI GGTGA 3 cut(s) 19, 248, 474
AvaII GGWCC 2 cut(s) 25, 425
BbvI GCAGC 7 cut(s) 58, 112, 124, 200, 203, 256, 430
BcnI CCSGG 1 cut(s) 117
BfaI CTAG 2 cut(s) 216, 326
BfoI RGCGCY 1 cut(s) 270
BisI GCNGC 8 cut(s) 72, 126, 138, 189, 192, 265, 270, 444
BlsI GCNGC 8 cut(s) 73, 127, 139, 190, 193, 266, 271, 445
Bme1390I CCNGG 1 cut(s) 117
Bme18I GGWCC 2 cut(s) 25, 425
BmgBI CACGTC 1 cut(s) 358
BmgT120I GGNCC 2 cut(s) 25, 425
BmiI GGNNCC 1 cut(s) 426
BmrFI CCNGG 1 cut(s) 117
BplI GAGNNNNNCTC 2 cut(s) 464, 496
BpuMI CCSGG 1 cut(s) 117
BsaAI YACGTR 1 cut(s) 59
BsaXI ACNNNNNCTCC 4 cut(s) 97, 127, 241, 271
Bsc4I CCNNNNNNNGG 3 cut(s) 34, 119, 263
Bse1I ACTGG 2 cut(s) 428, 503
Bse3DI GCAATG 1 cut(s) 201
BseLI CCNNNNNNNGG 3 cut(s) 34, 119, 263
BseMI GCAATG 1 cut(s) 201
BseNI ACTGG 2 cut(s) 428, 503
BseRI GAGGAG 1 cut(s) 485
BseXI GCAGC 7 cut(s) 58, 112, 124, 200, 203, 256, 430
BseYI CCCAGC 1 cut(s) 260
BsgI GTGCAG 1 cut(s) 474
BsiSI CCGG 1 cut(s) 117
BslI CCNNNNNNNGG 3 cut(s) 34, 119, 263
Bsp143I GATC 3 cut(s) 18, 172, 319
BspACI CCGC 4 cut(s) 120, 264, 494, 504
BspLI GGNNCC 1 cut(s) 426
BspPI GGATC 2 cut(s) 180, 327
BsrBI CCGCTC 1 cut(s) 504
BsrDI GCAATG 1 cut(s) 201
BsrI ACTGG 2 cut(s) 428, 503
BssMI GATC 3 cut(s) 18, 172, 319
BssNAI GTATAC 1 cut(s) 225
Bst1107I GTATAC 1 cut(s) 225
Bst4CI ACNGT 1 cut(s) 229
BstBAI YACGTR 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 437
BstH2I RGCGCY 1 cut(s) 270
BstHHI GCGC 1 cut(s) 269
BstKTI GATC 3 cut(s) 21, 175, 322
BstMBI GATC 3 cut(s) 18, 172, 319
BstMWI GCNNNNNNNGC 7 cut(s) 134, 143, 188, 212, 278, 287, 452
BstSCI CCNGG 1 cut(s) 115
BstV1I GCAGC 7 cut(s) 58, 112, 124, 200, 203, 256, 430
BstX2I RGATCY 2 cut(s) 172, 319
BstYI RGATCY 2 cut(s) 172, 319
BstZ17I GTATAC 1 cut(s) 225
BtrI CACGTC 1 cut(s) 358
BtsI GCAGTG 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 51
CaiI CAGNNNCTG 1 cut(s) 71
CfoI GCGC 1 cut(s) 269
Cfr13I GGNCC 2 cut(s) 25, 425
Csp6I GTAC 2 cut(s) 151, 298
CviAII CATG 2 cut(s) 141, 285
CviJI RGCY 4 cut(s) 71, 215, 290, 443
CviKI_1 RGCY 4 cut(s) 71, 215, 290, 443
CviQI GTAC 2 cut(s) 151, 298
DdeI CTNAG 1 cut(s) 437
DpnI GATC 3 cut(s) 20, 174, 321
DpnII GATC 3 cut(s) 18, 172, 319
Eco47I GGWCC 2 cut(s) 25, 425
FaeI CATG 2 cut(s) 144, 288
FaiI YATR 8 cut(s) 35, 135, 142, 179, 225, 279, 286, 412
FalI AAGNNNNNCTT 4 cut(s) 140, 172, 287, 319
FatI CATG 2 cut(s) 140, 284
FauI CCCGC 1 cut(s) 497
FblI GTMKAC 1 cut(s) 224
Fnu4HI GCNGC 8 cut(s) 72, 126, 138, 189, 192, 265, 270, 444
Fsp4HI GCNGC 8 cut(s) 72, 126, 138, 189, 192, 265, 270, 444
FspBI CTAG 2 cut(s) 216, 326
GlaI GCGC 1 cut(s) 268
GluI GCNGC 8 cut(s) 72, 126, 138, 189, 192, 265, 270, 444
GsaI CCCAGC 1 cut(s) 264
HaeII RGCGCY 1 cut(s) 270
HapII CCGG 1 cut(s) 117
HhaI GCGC 1 cut(s) 269
Hin1II CATG 2 cut(s) 144, 288
Hin6I GCGC 1 cut(s) 267
HinP1I GCGC 1 cut(s) 267
HincII GTYRAC 2 cut(s) 166, 313
HindII GTYRAC 2 cut(s) 166, 313
HinfI GANTC 1 cut(s) 479
HpaII CCGG 1 cut(s) 117
HphI GGTGA 3 cut(s) 19, 248, 474
Hpy166II GTNNAC 5 cut(s) 153, 166, 225, 300, 313
Hpy188I TCNGA 1 cut(s) 233
Hpy8I GTNNAC 5 cut(s) 153, 166, 225, 300, 313
HpyAV CCTTC 2 cut(s) 166, 313
HpyCH4III ACNGT 1 cut(s) 229
HpyCH4IV ACGT 2 cut(s) 58, 357
HpyCH4V TGCA 5 cut(s) 74, 140, 206, 393, 455
HpyF10VI GCNNNNNNNGC 7 cut(s) 134, 143, 188, 212, 278, 287, 452
HpyF3I CTNAG 1 cut(s) 437
HpySE526I ACGT 2 cut(s) 58, 357
Hsp92II CATG 2 cut(s) 144, 288
HspAI GCGC 1 cut(s) 267
Kzo9I GATC 3 cut(s) 18, 172, 319
LmnI GCTCC 1 cut(s) 501
LpnPI CCDG 4 cut(s) 130, 274, 441, 484
Lsp1109I GCAGC 7 cut(s) 58, 112, 124, 200, 203, 256, 430
MaeI CTAG 2 cut(s) 216, 326
MaeII ACGT 2 cut(s) 58, 357
MaeIII GTNAC 3 cut(s) 54, 236, 367
MalI GATC 3 cut(s) 20, 174, 321
MbiI CCGCTC 1 cut(s) 504
MboI GATC 3 cut(s) 18, 172, 319
MboII GAAGA 1 cut(s) 314
MflI RGATCY 2 cut(s) 172, 319
MluCI AATT 3 cut(s) 379, 460, 486
MlyI GAGTC 1 cut(s) 473
MmeI TCCRAC 4 cut(s) 67, 83, 211, 227
MnlI CCTC 5 cut(s) 83, 123, 227, 267, 463
MseI TTAA 2 cut(s) 200, 489
MspA1I CMGCKG 1 cut(s) 264
MspI CCGG 1 cut(s) 117
MspR9I CCNGG 1 cut(s) 117
MwoI GCNNNNNNNGC 7 cut(s) 134, 143, 188, 212, 278, 287, 452
NciI CCSGG 1 cut(s) 117
NdeII GATC 3 cut(s) 18, 172, 319
NlaIII CATG 2 cut(s) 144, 288
NlaIV GGNNCC 1 cut(s) 426
NmuCI GTSAC 2 cut(s) 236, 367
PkrI GCNGC 8 cut(s) 73, 127, 139, 190, 193, 266, 271, 445
PleI GAGTC 1 cut(s) 473
PpsI GAGTC 1 cut(s) 473
Ppu21I YACGTR 1 cut(s) 59
PshBI ATTAAT 1 cut(s) 489
PspFI CCCAGC 1 cut(s) 260
PspN4I GGNNCC 1 cut(s) 426
PspPI GGNCC 2 cut(s) 25, 425
PstNI CAGNNNCTG 1 cut(s) 71
PsuI RGATCY 2 cut(s) 172, 319
RsaI GTAC 2 cut(s) 152, 299
RsaNI GTAC 2 cut(s) 151, 298
SaqAI TTAA 2 cut(s) 200, 489
SatI GCNGC 8 cut(s) 72, 126, 138, 189, 192, 265, 270, 444
Sau3AI GATC 3 cut(s) 18, 172, 319
Sau96I GGNCC 2 cut(s) 25, 425
SchI GAGTC 1 cut(s) 473
ScrFI CCNGG 1 cut(s) 117
SetI ASST 9 cut(s) 9, 61, 73, 158, 217, 238, 305, 360, 445
SinI GGWCC 2 cut(s) 25, 425
Sse9I AATT 3 cut(s) 379, 460, 486
SsiI CCGC 4 cut(s) 120, 264, 494, 504
SspMI CTAG 2 cut(s) 216, 326
StyD4I CCNGG 1 cut(s) 115
TaaI ACNGT 1 cut(s) 229
TaiI ACGT 2 cut(s) 61, 360
TaqI TCGA 2 cut(s) 333, 384
TasI AATT 3 cut(s) 379, 460, 486
TatI WGTACW 2 cut(s) 150, 297
TauI GCSGC 1 cut(s) 267
Tru1I TTAA 2 cut(s) 200, 489
Tru9I TTAA 2 cut(s) 200, 489
TscAI CASTG 1 cut(s) 51
TseFI GTSAC 2 cut(s) 236, 367
TseI GCWGC 7 cut(s) 71, 125, 137, 188, 191, 269, 443
Tsp45I GTSAC 2 cut(s) 236, 367
TspDTI ATGAA 2 cut(s) 17, 273
TspGWI ACGGA 1 cut(s) 454
TspRI CASTG 1 cut(s) 51
VpaK11BI GGWCC 2 cut(s) 25, 425
VspI ATTAAT 1 cut(s) 489
XapI RAATTY 2 cut(s) 379, 460
XmiI GTMKAC 1 cut(s) 224
XspI CTAG 2 cut(s) 216, 326
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.