Rmu_sc0000516.1_g000006

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000516.1
Physical Location & Seq
Forward (+)
28194 .. 28775
582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000516.1_g000006.1.cds

Sequence Viewer

Length: 582 bp
atgtcgagtaatggttgtgagccaaatgttgatacttataccaaattgattgctggtttccttgaagcccgaaaagtggcggatgcactggagatgtttgatgagatgttaagtcgaggatttgttcctactatggggactataacctcttttatggaacccttatgtagctatggtccaccatatgctgctatgatgatctaccagaaagcaagaaaggtcggatgtagcatatcattgactgcttataagctattgcttatgcgcctttctagatttggtaaatgtggaatgttgctaaacatttgggatgagatgcaggaatgtggttatgcttctgatatcgaagtttatgagtatgtaatcagtggactttgcaacattgggcagcttgaaaatgctgtacttgtcatggaagagtctctacgaaaaggtttttgcccaagcaggcttacctatagcaaactaagtaacaaacttctagcttcaaataagttagagagggcttataagctatacttgaagattaaatctgctcgtcgttttgacaagacacagagaatttggtgtgctaggggatga

Protein Analysis

193

Amino Acids

21.88

Weight (kDa)

8.97

Isoelectric Point (pI)

31.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 249, 510
AciI CCGC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 561
AfaI GTAC 1 cut(s) 405
AfiI CCNNNNNNNGG 2 cut(s) 76, 134
AgsI TTSAA 4 cut(s) 65, 395, 489, 523
AluBI AGCT 5 cut(s) 171, 253, 391, 485, 514
AluI AGCT 5 cut(s) 171, 253, 391, 485, 514
Alw26I GTCTC 1 cut(s) 426
ApeKI GCWGC 2 cut(s) 188, 388
ApoI RAATTY 1 cut(s) 561
AspLEI GCGC 1 cut(s) 267
AspS9I GGNCC 1 cut(s) 176
AvaII GGWCC 1 cut(s) 176
BarI GAAGNNNNNNTAC 2 cut(s) 408, 440
BbvI GCAGC 2 cut(s) 175, 400
BcoDI GTCTC 1 cut(s) 426
BfaI CTAG 3 cut(s) 273, 482, 573
BfmI CTRYAG 1 cut(s) 457
BisI GCNGC 2 cut(s) 189, 389
BlsI GCNGC 2 cut(s) 190, 390
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 159
BmsI GCATC 2 cut(s) 73, 306
BpmI CTGGAG 1 cut(s) 110
Bsc4I CCNNNNNNNGG 2 cut(s) 76, 134
Bse1I ACTGG 1 cut(s) 93
BseGI GGATG 3 cut(s) 88, 230, 316
BseLI CCNNNNNNNGG 2 cut(s) 76, 134
BseNI ACTGG 1 cut(s) 93
BseXI GCAGC 2 cut(s) 175, 400
BslFI GGGAC 1 cut(s) 151
BslI CCNNNNNNNGG 2 cut(s) 76, 134
BsmAI GTCTC 1 cut(s) 426
BsmFI GGGAC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 198
BspACI CCGC 1 cut(s) 80
BspLI GGNNCC 1 cut(s) 159
BsrI ACTGG 1 cut(s) 93
BssMI GATC 1 cut(s) 198
Bst6I CTCTTC 1 cut(s) 411
BstC8I GCNNGC 1 cut(s) 449
BstDEI CTNAG 1 cut(s) 467
BstF5I GGATG 3 cut(s) 88, 230, 316
BstHHI GCGC 1 cut(s) 267
BstKTI GATC 1 cut(s) 201
BstMAI GTCTC 1 cut(s) 426
BstMBI GATC 1 cut(s) 198
BstSFI CTRYAG 1 cut(s) 457
BstV1I GCAGC 2 cut(s) 175, 400
BtsCI GGATG 3 cut(s) 88, 230, 316
BtsIMutI CAGTG 2 cut(s) 86, 373
Cac8I GCNNGC 1 cut(s) 449
CfoI GCGC 1 cut(s) 267
Cfr13I GGNCC 1 cut(s) 176
Csp6I GTAC 1 cut(s) 404
CviAII CATG 1 cut(s) 412
CviJI RGCY 9 cut(s) 22, 68, 171, 253, 391, 451, 485, 506, 514
CviKI_1 RGCY 9 cut(s) 22, 68, 171, 253, 391, 451, 485, 506, 514
CviQI GTAC 1 cut(s) 404
DdeI CTNAG 1 cut(s) 467
DpnI GATC 1 cut(s) 200
DpnII GATC 1 cut(s) 198
Eam1104I CTCTTC 1 cut(s) 411
EarI CTCTTC 1 cut(s) 411
EciI GGCGGA 1 cut(s) 95
Eco32I GATATC 1 cut(s) 343
Eco47I GGWCC 1 cut(s) 176
EcoRV GATATC 1 cut(s) 343
FaeI CATG 1 cut(s) 415
FalI AAGNNNNNCTT 2 cut(s) 503, 535
FaqI GGGAC 1 cut(s) 151
FatI CATG 1 cut(s) 411
FauNDI CATATG 1 cut(s) 184
Fnu4HI GCNGC 2 cut(s) 189, 389
FokI GGATG 3 cut(s) 95, 237, 323
Fsp4HI GCNGC 2 cut(s) 189, 389
FspBI CTAG 3 cut(s) 273, 482, 573
GlaI GCGC 1 cut(s) 266
GluI GCNGC 2 cut(s) 189, 389
GsuI CTGGAG 1 cut(s) 110
HhaI GCGC 1 cut(s) 267
Hin1II CATG 1 cut(s) 415
Hin6I GCGC 1 cut(s) 265
HinP1I GCGC 1 cut(s) 265
HinfI GANTC 1 cut(s) 419
Hpy166II GTNNAC 2 cut(s) 179, 371
Hpy188I TCNGA 2 cut(s) 224, 340
Hpy188III TCNNGA 1 cut(s) 273
Hpy8I GTNNAC 2 cut(s) 179, 371
Hpy99I CGWCG 1 cut(s) 543
HpyCH4V TGCA 3 cut(s) 86, 319, 378
HpyF3I CTNAG 1 cut(s) 467
Hsp92II CATG 1 cut(s) 415
HspAI GCGC 1 cut(s) 265
Kzo9I GATC 1 cut(s) 198
LpnPI CCDG 5 cut(s) 39, 74, 218, 305, 433
Lsp1109I GCAGC 2 cut(s) 175, 400
LweI GCATC 2 cut(s) 73, 306
MaeI CTAG 3 cut(s) 273, 482, 573
MaeIII GTNAC 1 cut(s) 470
MalI GATC 1 cut(s) 200
MboI GATC 1 cut(s) 198
MboII GAAGA 2 cut(s) 428, 535
MluCI AATT 2 cut(s) 44, 561
MlyI GAGTC 1 cut(s) 428
MmeI TCCRAC 1 cut(s) 202
MnlI CCTC 3 cut(s) 110, 157, 495
MseI TTAA 2 cut(s) 110, 528
NdeI CATATG 1 cut(s) 184
NdeII GATC 1 cut(s) 198
NlaIII CATG 1 cut(s) 415
NlaIV GGNNCC 1 cut(s) 159
PkrI GCNGC 2 cut(s) 190, 390
PleI GAGTC 1 cut(s) 427
PpsI GAGTC 1 cut(s) 427
PsiI TTATAA 2 cut(s) 249, 510
PspN4I GGNNCC 1 cut(s) 159
PspPI GGNCC 1 cut(s) 176
RsaI GTAC 1 cut(s) 405
RsaNI GTAC 1 cut(s) 404
SaqAI TTAA 2 cut(s) 110, 528
SatI GCNGC 2 cut(s) 189, 389
Sau3AI GATC 1 cut(s) 198
Sau96I GGNCC 1 cut(s) 176
SchI GAGTC 1 cut(s) 428
SetI ASST 9 cut(s) 149, 173, 222, 255, 393, 436, 458, 487, 516
SfaNI GCATC 2 cut(s) 73, 306
SfcI CTRYAG 1 cut(s) 457
SinI GGWCC 1 cut(s) 176
Sse9I AATT 2 cut(s) 44, 561
SsiI CCGC 1 cut(s) 80
SspMI CTAG 3 cut(s) 273, 482, 573
TaqI TCGA 3 cut(s) 5, 115, 345
TasI AATT 2 cut(s) 44, 561
TatI WGTACW 1 cut(s) 403
Tru1I TTAA 2 cut(s) 110, 528
Tru9I TTAA 2 cut(s) 110, 528
TscAI CASTG 2 cut(s) 93, 373
TseI GCWGC 2 cut(s) 188, 388
TspRI CASTG 2 cut(s) 93, 373
VpaK11BI GGWCC 1 cut(s) 176
XapI RAATTY 1 cut(s) 561
XbaI TCTAGA 1 cut(s) 272
XspI CTAG 3 cut(s) 273, 482, 573
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.