Rroxscaffold_5G00342010

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
10703214 .. 10703569
356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00342010.1

Sequence Viewer

Length: 321 bp
ATGAGGGGACTTCACACGAGAGAGAGCTTGAGTGAGGAACGGGCTTCTCTTTGGTCGAAGGTACTTTGGAAGAAGACAGATGAGGGACTTGTGGAGTCGGCGGACGCGCAGTTTTTGAATCGATCGGTCAAAGTGGCTACAATTTCGTTTCTTAATTCGGTGAAGGGGAAAGTGCGATTCAATGGCACTACGTATAACATTGTTATTGGTGGGTGGTCGAATTATGGTAGAGTTGGTGAGATGGAGAGGACTTTGGAAGCAATGGTAGCAGATGGGTATAGTCCCGATAGTGCAACTTTCGCCACAATCTTGAGGGTCTAG

Protein Analysis

106

Amino Acids

11.8

Weight (kDa)

9.1

Isoelectric Point (pI)

28.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 64 - 105 7.1e-07 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 107
AciI CCGC 1 cut(s) 101
AfaI GTAC 1 cut(s) 63
AgsI TTSAA 2 cut(s) 118, 181
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
AspLEI GCGC 1 cut(s) 109
AsuHPI GGTGA 2 cut(s) 172, 248
BauI CACGAG 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 80
BccI CCATC 2 cut(s) 235, 266
BfaI CTAG 1 cut(s) 319
BpiI GAAGAC 1 cut(s) 80
BpuEI CTTGAG 1 cut(s) 49
Bsa29I ATCGAT 1 cut(s) 121
BsaAI YACGTR 1 cut(s) 192
Bse3DI GCAATG 1 cut(s) 267
BseCI ATCGAT 1 cut(s) 121
BseMI GCAATG 1 cut(s) 267
Bsh1236I CGCG 1 cut(s) 107
Bsh1285I CGRYCG 1 cut(s) 125
BshVI ATCGAT 1 cut(s) 121
BsiEI CGRYCG 1 cut(s) 125
BslFI GGGAC 3 cut(s) 21, 99, 267
BsmFI GGGAC 3 cut(s) 21, 99, 267
Bsp143I GATC 1 cut(s) 122
BspACI CCGC 1 cut(s) 101
BspDI ATCGAT 1 cut(s) 121
BspFNI CGCG 1 cut(s) 107
BsrDI GCAATG 1 cut(s) 267
BssMI GATC 1 cut(s) 122
BssSI CACGAG 1 cut(s) 16
Bst2BI CACGAG 1 cut(s) 16
BstBAI YACGTR 1 cut(s) 192
BstFNI CGCG 1 cut(s) 107
BstHHI GCGC 1 cut(s) 109
BstKTI GATC 1 cut(s) 125
BstMBI GATC 1 cut(s) 122
BstMCI CGRYCG 1 cut(s) 125
BstMWI GCNNNNNNNGC 2 cut(s) 266, 299
BstSNI TACGTA 1 cut(s) 192
BstUI CGCG 1 cut(s) 107
BstV2I GAAGAC 1 cut(s) 80
Bsu15I ATCGAT 1 cut(s) 121
BsuTUI ATCGAT 1 cut(s) 121
CfoI GCGC 1 cut(s) 109
ClaI ATCGAT 1 cut(s) 121
CseI GACGC 1 cut(s) 113
Csp6I GTAC 1 cut(s) 62
CviJI RGCY 3 cut(s) 27, 44, 137
CviKI_1 RGCY 3 cut(s) 27, 44, 137
CviQI GTAC 1 cut(s) 62
DpnI GATC 1 cut(s) 124
DpnII GATC 1 cut(s) 122
EciI GGCGGA 1 cut(s) 116
Eco105I TACGTA 1 cut(s) 192
FaiI YATR 3 cut(s) 195, 225, 279
FaqI GGGAC 3 cut(s) 21, 99, 267
FspBI CTAG 1 cut(s) 319
GlaI GCGC 1 cut(s) 108
HgaI GACGC 1 cut(s) 113
HhaI GCGC 1 cut(s) 109
Hin6I GCGC 1 cut(s) 107
HinP1I GCGC 1 cut(s) 107
HinfI GANTC 3 cut(s) 95, 118, 177
HphI GGTGA 2 cut(s) 172, 248
Hpy188III TCNNGA 2 cut(s) 284, 310
HpyAV CCTTC 2 cut(s) 52, 157
HpyCH4IV ACGT 1 cut(s) 191
HpyCH4V TGCA 1 cut(s) 293
HpyF10VI GCNNNNNNNGC 2 cut(s) 266, 299
HpySE526I ACGT 1 cut(s) 191
HspAI GCGC 1 cut(s) 107
Kzo9I GATC 1 cut(s) 122
MaeI CTAG 1 cut(s) 319
MaeII ACGT 1 cut(s) 191
MalI GATC 1 cut(s) 124
MboI GATC 1 cut(s) 122
MboII GAAGA 2 cut(s) 82, 85
MluCI AATT 3 cut(s) 141, 154, 220
MlyI GAGTC 1 cut(s) 104
MnlI CCTC 4 cut(s) 28, 76, 240, 306
MseI TTAA 1 cut(s) 153
MvnI CGCG 1 cut(s) 107
MwoI GCNNNNNNNGC 2 cut(s) 266, 299
NdeII GATC 1 cut(s) 122
PfeI GAWTC 2 cut(s) 118, 177
Ple19I CGATCG 1 cut(s) 125
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
Ppu21I YACGTR 1 cut(s) 192
PvuI CGATCG 1 cut(s) 125
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
SaqAI TTAA 1 cut(s) 153
Sau3AI GATC 1 cut(s) 122
SchI GAGTC 1 cut(s) 104
SetI ASST 3 cut(s) 29, 63, 194
SgeI CNNG 7 cut(s) 28, 30, 40, 53, 101, 118, 296
SmlI CTYRAG 2 cut(s) 28, 310
SmoI CTYRAG 2 cut(s) 28, 310
SnaBI TACGTA 1 cut(s) 192
Sse9I AATT 3 cut(s) 141, 154, 220
SsiI CCGC 1 cut(s) 101
SspMI CTAG 1 cut(s) 319
TaiI ACGT 1 cut(s) 194
TaqI TCGA 3 cut(s) 56, 121, 218
TaqII GACCGA 1 cut(s) 115
TasI AATT 3 cut(s) 141, 154, 220
TfiI GAWTC 2 cut(s) 118, 177
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
XspI CTAG 1 cut(s) 319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.