Rmu_sc0001531.1_g000028

Putative S-adenosyl-L-methionine-dependent methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001531.1
Physical Location & Seq
Forward (+)
83676 .. 87658
3983 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001531.1_g000028.1.cds

Sequence Viewer

Length: 1878 bp
atgatgaggggaagatctgatccagcccaaaagaagcgcgtgatcatcattctgtgtgttttggcactctttcttgttttcctgtatgggtattatggttccatctttggctctcaaagtcatggtgcatcagctctagaatatggcagtagatctttgagaaagcttggttcatcttatttgggtggggatgatgataccgatggcaagctggatgaatcttcaacaaagtttgggcaggaagatggagatgatgatgttacagtgaagagcttcccggtttgtgatgatcgccattcggaacttatcccttgcttggacagaaatctcatatatcaaatgagactgaagttggacctgtctttgatggagcactatgagaggcattgtccttctccagaaaggcgatacaattgcttgattcctcctccaatagggtacaaggtcccaatcaaatggccccagagcagagatgaagtatggaaagcaaatatacctcatactcaccttgcacatgagaaatccgaccagaactggatggttgaaaagggtgacaagattagttttcctgggggaggcacacattttcactatggagctgataagtatattgcttcaattgcaaatatgctcaactttacaaagaacaatctaaacaatgaaggcaggttacgtacagtttttgacgttggctgtggagttgcaagttttggaggctatcttctgtcatctgatattatgacaatgtccttagcacccaatgatgtgcatcaaaatcaaatccaatttgctttggaaagaggaattccagcatatcttggtgttctagggaccaaaaggcttccttacccaagcagatcttttgaacttgctcactgttcccgttgtagaattgattggctccaaagagatgggatccttcttcttgagctagataggttactcaggccaggaggctactttgcgtactcatctccagaagcatatgcacaggatgaggaagatctcaaaatatggaaagagatgagtgcccttgtggagcgcatgtgttggagaatagctgcaaaaaggaaccaaactgtcatttggcagaaaccactaacaaatgactgttatatacaaagagaacctggcactcaacctcctctctgccgatctgatgatgatccagatgcaatctggggtgtgccaatggaagcttgcatctcaccgtactctgatcatgaccatagagaaaaggggagtggattggctccctggccagctagattgacaactcctcctcctcgacttgctgattttggctattcaaatgaaatgtttgaaaaggacatggaactttggcggcatcgagttgagaattattggaatctcttgagtccaaagattgaatcaaacactctgaggaatgtgatggatatgaaagcacacatgggatcatttgcagctgctctgaaggacaaggatgtttgggtgatgaatgtcgtccctgaagatggaccaaacacactaaagctgatatacgacagaggccttataggcagtattcacagctggtgtgaagcctattcaacatacccccgtacttatgatttactccatgcttggactgtcttctctgacttggaaaagaaagaatgcagtgctgaggatctgttgcttgagatggatcgcatactcaggccaactggatttataattatccgtgacaaacagtcagtggttgatttagttaagaaatatctgccagcactgcactgggaagtagtggcacaaaccgactccagttcagattccgaccaggacggagatgacgttgtacttataatccaaaagaaaatatggctgacaagtgacagcctcagggattcagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

625

Amino Acids

71.34

Weight (kDa)

5.63

Isoelectric Point (pI)

42.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000529)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G04430 AT1G04430 AT1G04430 AT3G23300 AT3G23300 AT4G14360 AT4G14360
fragaria_vesca FvH4_2g21260 FvH4_2g21260 FvH4_2g21260 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770
malus_domestica MD05G1195000.v1.1 MD10G1181600.v1.1 MD10G1182100.v1.1 MD13G1215000.v1.1
prunus_persica Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.8G221700_v2.0.a1 Prupe.8G221700_v2.0.a1 Prupe.8G221700_v2.0.a1
pyrus_communis pycom05g18230 pycom10g15760 pycom10g15770 pycom111g01800
rosa_chinensis RchiOBHm_Chr4g0393501 RchiOBHm_Chr4g0393511 RchiOBHm_Chr4g0393631 RchiOBHm_Chr6g0287841
rosa_laevigata RLG00000009742 RLG00000012463
rosa_multiflora Rmu_sc0001531.1_g000028 Rmu_sc0003877.1_g000004 Rmu_sc0007724.1_g000003 Rmu_sc0008931.1_g000001 Rmu_sc0015036.1_g000004 Rmu_sc0021463.1_g000002 Rmu_sc0023299.1_g000001 Rmu_sc0023300.1_g000001 Rmu_sc0036005.1_g000001
rosa_roxburghii Rroxscaffold_5G00338440 Rroxscaffold_5G00338470 Rroxscaffold_5G00338730 Rroxscaffold_5G00338790 Rroxscaffold_7G00180730 Rroxscaffold_7G00180820
rosa_rugosa Rorug03G0372400 Rorug03G0372500 Rorug03G0372600 Rorug04G0000100 Rorug04G0000200 Rorug04G0000300 Rorug04G0000400 Rorug04G0000500 Rorug04G0000600.1 Rorug04G0000700 Rorug04G0000800 Rorug04G0000900 Rorug06G0192300 Rorug06G0192400 Rorug06G0192500
rosa_samantha Rh4AG047800 Rh4AG048100 Rh4BG043700 Rh4BG044600 Rh4CG050500 Rh4CG050600 Rh4CG050700 Rh4CG051400 Rh4DG045000 Rh4DG045300 Rh6AG302000 Rh6BG307900 Rh6CG301600 Rh6CG315800 Rh6DG300500
rosa_wichuraiana Rw4G003770 Rw4G003800 Rw6G026090

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1697, 1826
Acc36I ACCTGC 1 cut(s) 657
AccII CGCG 1 cut(s) 39
AciI CCGC 1 cut(s) 1345
AclWI GGATC 7 cut(s) 14, 910, 923, 1160, 1444, 1659, 1677
AcoI YGGCCR 1 cut(s) 1259
AcsI RAATTY 1 cut(s) 804
AcuI CTGAAG 3 cut(s) 368, 1475, 1512
AfaI GTAC 6 cut(s) 440, 676, 968, 1214, 1585, 1821
AfiI CCNNNNNNNGG 4 cut(s) 316, 434, 575, 1496
AgsI TTSAA 8 cut(s) 225, 545, 618, 866, 1311, 1325, 1391, 1572
AhdI GACNNNNNGTC 1 cut(s) 1714
AjnI CCWGG 5 cut(s) 568, 949, 1129, 1256, 1800
Alw21I GWGCWC 1 cut(s) 375
Alw26I GTCTC 1 cut(s) 337
AlwI GGATC 7 cut(s) 14, 910, 923, 1160, 1444, 1659, 1677
AoxI GGCC 5 cut(s) 458, 947, 1259, 1531, 1682
ApeKI GCWGC 3 cut(s) 1061, 1445, 1448
ApoI RAATTY 1 cut(s) 804
Asp700I GAANNNNTTC 1 cut(s) 272
AspLEI GCGC 2 cut(s) 39, 1044
AspS9I GGNCC 5 cut(s) 355, 445, 459, 831, 1499
AsuC2I CCSGG 1 cut(s) 278
AsuHPI GGTGA 4 cut(s) 497, 563, 1200, 1486
AvaII GGWCC 4 cut(s) 355, 445, 831, 1499
AxyI CCTNAGG 1 cut(s) 1862
BaeGI GKGCMC 1 cut(s) 1033
BalI TGGCCA 1 cut(s) 1261
BamHI GGATCC 1 cut(s) 915
BarI GAAGNNNNNNTAC 2 cut(s) 654, 686
BbsI GAAGAC 1 cut(s) 1606
Bbv12I GWGCWC 1 cut(s) 375
BbvCI CCTCAGC 1 cut(s) 1647
BbvI GCAGC 3 cut(s) 1048, 1435, 1457
BccI CCATC 9 cut(s) 110, 197, 239, 361, 532, 905, 1408, 1490, 1660
BcgI CGANNNNNNTGC 2 cut(s) 396, 430
BciT130I CCWGG 5 cut(s) 570, 951, 1131, 1258, 1802
BclI TGATCA 2 cut(s) 42, 1219
BcnI CCSGG 1 cut(s) 278
BcoDI GTCTC 1 cut(s) 337
BfaI CTAG 4 cut(s) 137, 827, 932, 1266
BfuAI ACCTGC 1 cut(s) 657
BglI GCCNNNNNGGC 1 cut(s) 1539
BglII AGATCT 4 cut(s) 14, 152, 857, 1003
BisI GCNGC 4 cut(s) 1062, 1346, 1446, 1449
BlsI GCNGC 4 cut(s) 1063, 1347, 1447, 1450
Bme1390I CCNGG 6 cut(s) 278, 570, 951, 1131, 1258, 1802
Bme18I GGWCC 4 cut(s) 355, 445, 831, 1499
BmeRI GACNNNNNGTC 1 cut(s) 1714
BmgT120I GGNCC 5 cut(s) 355, 445, 459, 831, 1499
BmiI GGNNCC 8 cut(s) 100, 447, 461, 832, 902, 917, 1073, 1254
BmrFI CCNGG 6 cut(s) 278, 570, 951, 1131, 1258, 1802
BmrI ACTGGG 1 cut(s) 1768
BmsI GCATC 5 cut(s) 137, 778, 1162, 1212, 1357
BmuI ACTGGG 1 cut(s) 1768
BpiI GAAGAC 1 cut(s) 1606
BpmI CTGGAG 3 cut(s) 381, 960, 1768
Bpu10I CCTNAGC 2 cut(s) 751, 1647
BpuEI CTTGAG 3 cut(s) 947, 1396, 1682
BpuMI CCSGG 1 cut(s) 278
BsaAI YACGTR 1 cut(s) 674
BsaBI GATNNNNATC 2 cut(s) 768, 1164
BsaJI CCNNGG 2 cut(s) 569, 1256
Bsc4I CCNNNNNNNGG 4 cut(s) 316, 434, 575, 1496
Bse1I ACTGG 4 cut(s) 539, 1693, 1763, 1785
Bse21I CCTNAGG 1 cut(s) 1862
Bse8I GATNNNNATC 2 cut(s) 768, 1164
BseBI CCWGG 5 cut(s) 570, 951, 1131, 1258, 1802
BseDI CCNNGG 2 cut(s) 569, 1256
BseGI GGATG 5 cut(s) 196, 220, 543, 1000, 1471
BseJI GATNNNNATC 2 cut(s) 768, 1164
BseLI CCNNNNNNNGG 4 cut(s) 316, 434, 575, 1496
BseMII CTCAG 5 cut(s) 958, 1394, 1638, 1693, 1876
BseNI ACTGG 4 cut(s) 539, 1693, 1763, 1785
BseRI GAGGAG 5 cut(s) 417, 1134, 1269, 1272, 1275
BseSI GKGCMC 1 cut(s) 1033
BseXI GCAGC 3 cut(s) 1048, 1435, 1457
BsgI GTGCAG 1 cut(s) 1739
Bsh1236I CGCG 1 cut(s) 39
BshFI GGCC 5 cut(s) 460, 949, 1261, 1533, 1684
BsiHKAI GWGCWC 1 cut(s) 375
BsiSI CCGG 1 cut(s) 278
BslFI GGGAC 3 cut(s) 431, 844, 1472
BslI CCNNNNNNNGG 4 cut(s) 316, 434, 575, 1496
BsmAI GTCTC 1 cut(s) 337
BsmFI GGGAC 3 cut(s) 431, 844, 1472
BsmI GAATGC 1 cut(s) 1643
BsnI GGCC 5 cut(s) 460, 949, 1261, 1533, 1684
Bsp1286I GDGCHC 2 cut(s) 375, 1033
BspACI CCGC 1 cut(s) 1345
BspANI GGCC 5 cut(s) 460, 949, 1261, 1533, 1684
BspCNI CTCAG 5 cut(s) 957, 1395, 1639, 1692, 1875
BspFNI CGCG 1 cut(s) 39
BspHI TCATGA 1 cut(s) 1222
BspLI GGNNCC 8 cut(s) 100, 447, 461, 832, 902, 917, 1073, 1254
BspMI ACCTGC 1 cut(s) 657
BspPI GGATC 7 cut(s) 14, 910, 923, 1160, 1444, 1659, 1677
BspQI GCTCTTC 1 cut(s) 263
BsrI ACTGG 4 cut(s) 539, 1693, 1763, 1785
BssECI CCNNGG 2 cut(s) 569, 1256
Bst2UI CCWGG 5 cut(s) 570, 951, 1131, 1258, 1802
Bst4CI ACNGT 8 cut(s) 265, 679, 878, 1081, 1112, 1212, 1612, 1716
Bst6I CTCTTC 1 cut(s) 263
BstBAI YACGTR 1 cut(s) 674
BstC8I GCNNGC 4 cut(s) 209, 1201, 1263, 1749
BstDEI CTNAG 6 cut(s) 751, 944, 1403, 1647, 1679, 1862
BstENI CCTNNNNNAGG 2 cut(s) 432, 573
BstF5I GGATG 5 cut(s) 196, 220, 543, 1000, 1471
BstFNI CGCG 1 cut(s) 39
BstHHI GCGC 2 cut(s) 39, 1044
BstMAI GTCTC 1 cut(s) 337
BstMWI GCNNNNNNNGC 3 cut(s) 620, 1539, 1753
BstNI CCWGG 5 cut(s) 570, 951, 1131, 1258, 1802
BstNSI RCATGY 1 cut(s) 1048
BstSCI CCNGG 6 cut(s) 276, 568, 949, 1129, 1256, 1800
BstSLI GKGCMC 1 cut(s) 1033
BstSNI TACGTA 1 cut(s) 674
BstUI CGCG 1 cut(s) 39
BstV1I GCAGC 3 cut(s) 1048, 1435, 1457
BstV2I GAAGAC 1 cut(s) 1606
BstX2I RGATCY 6 cut(s) 14, 152, 857, 915, 1003, 1651
BstXI CCANNNNNNTGG 2 cut(s) 456, 911
BstYI RGATCY 6 cut(s) 14, 152, 857, 915, 1003, 1651
Bsu36I CCTNAGG 1 cut(s) 1862
BsuRI GGCC 5 cut(s) 460, 949, 1261, 1533, 1684
BtsCI GGATG 5 cut(s) 196, 220, 543, 1000, 1471
BtsI GCAGTG 2 cut(s) 1648, 1751
BtsIMutI CAGTG 6 cut(s) 270, 874, 1648, 1725, 1751, 1756
BveI ACCTGC 1 cut(s) 657
Cac8I GCNNGC 4 cut(s) 209, 1201, 1263, 1749
CciI TCATGA 1 cut(s) 1222
CfoI GCGC 2 cut(s) 39, 1044
Cfr13I GGNCC 5 cut(s) 355, 445, 459, 831, 1499
Csp6I GTAC 6 cut(s) 439, 675, 967, 1213, 1584, 1820
CviAII CATG 7 cut(s) 122, 515, 1045, 1223, 1333, 1432, 1601
CviQI GTAC 6 cut(s) 439, 675, 967, 1213, 1584, 1820
DdeI CTNAG 6 cut(s) 751, 944, 1403, 1647, 1679, 1862
DriI GACNNNNNGTC 1 cut(s) 1714
EaeI YGGCCR 1 cut(s) 1259
Eam1104I CTCTTC 1 cut(s) 263
Eam1105I GACNNNNNGTC 1 cut(s) 1714
EarI CTCTTC 1 cut(s) 263
Eco105I TACGTA 1 cut(s) 674
Eco147I AGGCCT 1 cut(s) 1533
Eco47I GGWCC 4 cut(s) 355, 445, 831, 1499
Eco57I CTGAAG 3 cut(s) 368, 1475, 1512
Eco81I CCTNAGG 1 cut(s) 1862
EcoNI CCTNNNNNAGG 2 cut(s) 432, 573
EcoO109I RGGNCCY 1 cut(s) 445
EcoRI GAATTC 1 cut(s) 804
EcoRII CCWGG 5 cut(s) 568, 949, 1129, 1256, 1800
FaeI CATG 7 cut(s) 125, 518, 1048, 1226, 1336, 1435, 1604
FalI AAGNNNNNCTT 4 cut(s) 829, 861, 844, 876
FaqI GGGAC 3 cut(s) 431, 844, 1472
FatI CATG 7 cut(s) 121, 514, 1044, 1222, 1332, 1431, 1600
FauNDI CATATG 1 cut(s) 985
FbaI TGATCA 2 cut(s) 42, 1219
Fnu4HI GCNGC 4 cut(s) 1062, 1346, 1446, 1449
FokI GGATG 5 cut(s) 203, 227, 550, 1007, 1478
Fsp4HI GCNGC 4 cut(s) 1062, 1346, 1446, 1449
FspBI CTAG 4 cut(s) 137, 827, 932, 1266
GlaI GCGC 2 cut(s) 38, 1043
GluI GCNGC 4 cut(s) 1062, 1346, 1446, 1449
GsuI CTGGAG 3 cut(s) 381, 960, 1768
HaeIII GGCC 5 cut(s) 460, 949, 1261, 1533, 1684
HapII CCGG 1 cut(s) 278
HhaI GCGC 2 cut(s) 39, 1044
Hin1II CATG 7 cut(s) 125, 518, 1048, 1226, 1336, 1435, 1604
Hin6I GCGC 2 cut(s) 37, 1042
HinP1I GCGC 2 cut(s) 37, 1042
HindIII AAGCTT 2 cut(s) 164, 1197
HinfI GANTC 8 cut(s) 218, 421, 1369, 1378, 1391, 1781, 1793, 1868
HpaII CCGG 1 cut(s) 278
HphI GGTGA 4 cut(s) 497, 563, 1200, 1486
Hpy188III TCNNGA 7 cut(s) 137, 398, 926, 977, 1169, 1223, 1375
HpyAV CCTTC 4 cut(s) 402, 656, 929, 1450
HpyCH4III ACNGT 8 cut(s) 265, 679, 878, 1081, 1112, 1212, 1612, 1716
HpyCH4IV ACGT 3 cut(s) 673, 687, 1815
HpyF10VI GCNNNNNNNGC 3 cut(s) 620, 1539, 1753
HpyF3I CTNAG 6 cut(s) 751, 944, 1403, 1647, 1679, 1862
HpySE526I ACGT 3 cut(s) 673, 687, 1815
Hsp92II CATG 7 cut(s) 125, 518, 1048, 1226, 1336, 1435, 1604
HspAI GCGC 2 cut(s) 37, 1042
Ksp22I TGATCA 2 cut(s) 42, 1219
LguI GCTCTTC 1 cut(s) 263
LmnI GCTCC 5 cut(s) 370, 596, 906, 1039, 1258
Lsp1109I GCAGC 3 cut(s) 1048, 1435, 1457
LweI GCATC 5 cut(s) 137, 778, 1162, 1212, 1357
MaeI CTAG 4 cut(s) 137, 827, 932, 1266
MaeII ACGT 3 cut(s) 673, 687, 1815
MaeIII GTNAC 6 cut(s) 259, 551, 669, 939, 1706, 1853
MboII GAAGA 9 cut(s) 24, 213, 254, 280, 713, 914, 1013, 1505, 1606
MfeI CAATTG 2 cut(s) 412, 618
MflI RGATCY 6 cut(s) 14, 152, 857, 915, 1003, 1651
MhlI GDGCHC 2 cut(s) 375, 1033
MlsI TGGCCA 1 cut(s) 1261
MluCI AATT 7 cut(s) 412, 618, 785, 804, 891, 1360, 1698
MluNI TGGCCA 1 cut(s) 1261
MlyI GAGTC 2 cut(s) 1387, 1775
MmeI TCCRAC 4 cut(s) 333, 549, 1031, 1821
Mox20I TGGCCA 1 cut(s) 1261
MroXI GAANNNNTTC 1 cut(s) 272
MscI TGGCCA 1 cut(s) 1261
MseI TTAA 1 cut(s) 1734
Msp20I TGGCCA 1 cut(s) 1261
MspA1I CMGCKG 2 cut(s) 1448, 1554
MspI CCGG 1 cut(s) 278
MspR9I CCNGG 6 cut(s) 278, 570, 951, 1131, 1258, 1802
MunI CAATTG 2 cut(s) 412, 618
Mva1269I GAATGC 1 cut(s) 1643
MvaI CCWGG 5 cut(s) 570, 951, 1131, 1258, 1802
MvnI CGCG 1 cut(s) 39
MwoI GCNNNNNNNGC 3 cut(s) 620, 1539, 1753
NciI CCSGG 1 cut(s) 278
NdeI CATATG 1 cut(s) 985
NlaIII CATG 7 cut(s) 125, 518, 1048, 1226, 1336, 1435, 1604
NlaIV GGNNCC 8 cut(s) 100, 447, 461, 832, 902, 917, 1073, 1254
NmuCI GTSAC 3 cut(s) 551, 1706, 1853
NspI RCATGY 1 cut(s) 1048
PagI TCATGA 1 cut(s) 1222
PceI AGGCCT 1 cut(s) 1533
PciSI GCTCTTC 1 cut(s) 263
PcsI WCGNNNNNNNCGW 1 cut(s) 1812
PctI GAATGC 1 cut(s) 1643
PdmI GAANNNNTTC 1 cut(s) 272
PfeI GAWTC 6 cut(s) 218, 421, 1369, 1391, 1793, 1868
PflFI GACNNNGTC 1 cut(s) 745
PkrI GCNGC 4 cut(s) 1063, 1347, 1447, 1450
PleI GAGTC 2 cut(s) 1386, 1775
PpsI GAGTC 2 cut(s) 1386, 1775
Ppu21I YACGTR 1 cut(s) 674
PpuMI RGGWCCY 1 cut(s) 445
PsiI TTATAA 2 cut(s) 1697, 1826
Psp5II RGGWCCY 1 cut(s) 445
Psp6I CCWGG 5 cut(s) 568, 949, 1129, 1256, 1800
PspGI CCWGG 5 cut(s) 568, 949, 1129, 1256, 1800
PspN4I GGNNCC 8 cut(s) 100, 447, 461, 832, 902, 917, 1073, 1254
PspPI GGNCC 5 cut(s) 355, 445, 459, 831, 1499
PspPPI RGGWCCY 1 cut(s) 445
PsuI RGATCY 6 cut(s) 14, 152, 857, 915, 1003, 1651
PsyI GACNNNGTC 1 cut(s) 745
PvuII CAGCTG 2 cut(s) 1448, 1554
RsaI GTAC 6 cut(s) 440, 676, 968, 1214, 1585, 1821
RsaNI GTAC 6 cut(s) 439, 675, 967, 1213, 1584, 1820
SapI GCTCTTC 1 cut(s) 263
SaqAI TTAA 1 cut(s) 1734
SatI GCNGC 4 cut(s) 1062, 1346, 1446, 1449
Sau96I GGNCC 5 cut(s) 355, 445, 459, 831, 1499
SchI GAGTC 2 cut(s) 1387, 1775
ScrFI CCNGG 6 cut(s) 278, 570, 951, 1131, 1258, 1802
SduI GDGCHC 2 cut(s) 375, 1033
SfaNI GCATC 5 cut(s) 137, 778, 1162, 1212, 1357
SinI GGWCC 4 cut(s) 355, 445, 831, 1499
SmlI CTYRAG 3 cut(s) 926, 1375, 1661
SmoI CTYRAG 3 cut(s) 926, 1375, 1661
SnaBI TACGTA 1 cut(s) 674
Sse9I AATT 7 cut(s) 412, 618, 785, 804, 891, 1360, 1698
SseBI AGGCCT 1 cut(s) 1533
SsiI CCGC 1 cut(s) 1345
SspMI CTAG 4 cut(s) 137, 827, 932, 1266
StuI AGGCCT 1 cut(s) 1533
StyD4I CCNGG 6 cut(s) 276, 568, 949, 1129, 1256, 1800
TaaI ACNGT 8 cut(s) 265, 679, 878, 1081, 1112, 1212, 1612, 1716
TaiI ACGT 3 cut(s) 676, 690, 1818
TaqI TCGA 2 cut(s) 1288, 1351
TasI AATT 7 cut(s) 412, 618, 785, 804, 891, 1360, 1698
TatI WGTACW 1 cut(s) 1819
TauI GCSGC 1 cut(s) 1348
TfiI GAWTC 6 cut(s) 218, 421, 1369, 1391, 1793, 1868
Tru1I TTAA 1 cut(s) 1734
Tru9I TTAA 1 cut(s) 1734
TscAI CASTG 6 cut(s) 270, 881, 1648, 1725, 1758, 1763
TseFI GTSAC 3 cut(s) 551, 1706, 1853
TseI GCWGC 3 cut(s) 1061, 1445, 1448
Tsp45I GTSAC 3 cut(s) 551, 1706, 1853
TspDTI ATGAA 7 cut(s) 162, 231, 489, 675, 1329, 1436, 1493
TspGWI ACGGA 2 cut(s) 1694, 1821
TspRI CASTG 6 cut(s) 270, 881, 1648, 1725, 1758, 1763
Tth111I GACNNNGTC 1 cut(s) 745
VpaK11BI GGWCC 4 cut(s) 355, 445, 831, 1499
XagI CCTNNNNNAGG 2 cut(s) 432, 573
XapI RAATTY 1 cut(s) 804
XbaI TCTAGA 1 cut(s) 136
XceI RCATGY 1 cut(s) 1048
XcmI CCANNNNNNNNNTGG 2 cut(s) 1176, 1755
XmnI GAANNNNTTC 1 cut(s) 272
XspI CTAG 4 cut(s) 137, 827, 932, 1266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.