Rorug04G0000400

Putative S-adenosyl-L-methionine-dependent methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0000529
Physical Location & Seq
Forward (+)
100756 .. 101159
404 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0000400.1

Sequence Viewer

Length: 261 bp
ATGGTCATGGAATCTTACACAATCCCATGGAATCAAATGAGAACACACAGAACCTTCAACTGCCACGGAGATGCAAATATGGAAGTTACGATCATCCATAGTATAGCACGCATACATGTCAATCATACTGTCATATTGAGATGCTTTATAGATAAGGGGTCTGGGGGACTTTATCCTCTGTCAGGTACGGAAGTGAAGTTCAACGGAACAAGAGAACTAAATATGATACAGCAAACTATACGGATAACGATTGTGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Methyltransf_29 zf-C3HC4_3

Protein Analysis

86

Amino Acids

9.87

Weight (kDa)

8.81

Isoelectric Point (pI)

19.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000529)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G04430 AT1G04430 AT1G04430 AT3G23300 AT3G23300 AT4G14360 AT4G14360
fragaria_vesca FvH4_2g21260 FvH4_2g21260 FvH4_2g21260 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770
malus_domestica MD05G1195000.v1.1 MD10G1181600.v1.1 MD10G1182100.v1.1 MD13G1215000.v1.1
prunus_persica Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.8G221700_v2.0.a1 Prupe.8G221700_v2.0.a1 Prupe.8G221700_v2.0.a1
pyrus_communis pycom05g18230 pycom10g15760 pycom10g15770 pycom111g01800
rosa_chinensis RchiOBHm_Chr4g0393501 RchiOBHm_Chr4g0393511 RchiOBHm_Chr4g0393631 RchiOBHm_Chr6g0287841
rosa_laevigata RLG00000009742 RLG00000012463
rosa_multiflora Rmu_sc0001531.1_g000028 Rmu_sc0003877.1_g000004 Rmu_sc0007724.1_g000003 Rmu_sc0008931.1_g000001 Rmu_sc0015036.1_g000004 Rmu_sc0021463.1_g000002 Rmu_sc0023299.1_g000001 Rmu_sc0023300.1_g000001 Rmu_sc0036005.1_g000001
rosa_roxburghii Rroxscaffold_5G00338440 Rroxscaffold_5G00338470 Rroxscaffold_5G00338730 Rroxscaffold_5G00338790 Rroxscaffold_7G00180730 Rroxscaffold_7G00180820
rosa_rugosa Rorug03G0372400 Rorug03G0372500 Rorug03G0372600 Rorug04G0000100 Rorug04G0000200 Rorug04G0000300 Rorug04G0000400 Rorug04G0000500 Rorug04G0000600.1 Rorug04G0000700 Rorug04G0000800 Rorug04G0000900 Rorug06G0192300 Rorug06G0192400 Rorug06G0192500
rosa_samantha Rh4AG047800 Rh4AG048100 Rh4BG043700 Rh4BG044600 Rh4CG050500 Rh4CG050600 Rh4CG050700 Rh4CG051400 Rh4DG045000 Rh4DG045300 Rh6AG302000 Rh6BG307900 Rh6CG301600 Rh6CG315800 Rh6DG300500
rosa_wichuraiana Rw4G003770 Rw4G003800 Rw6G026090

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 182
AflIII ACRYGT 1 cut(s) 115
AgsI TTSAA 2 cut(s) 58, 202
AloI GAACNNNNNNTCC 2 cut(s) 182, 214
BaeI ACNNNNGTAYC 2 cut(s) 177, 210
BmsI GCATC 2 cut(s) 61, 131
BsaJI CCNNGG 2 cut(s) 26, 64
Bsc4I CCNNNNNNNGG 1 cut(s) 182
BseDI CCNNGG 2 cut(s) 26, 64
BseGI GGATG 1 cut(s) 93
BseLI CCNNNNNNNGG 1 cut(s) 182
BslFI GGGAC 1 cut(s) 180
BslI CCNNNNNNNGG 1 cut(s) 182
BsmFI GGGAC 1 cut(s) 180
Bsp143I GATC 1 cut(s) 90
Bsp19I CCATGG 1 cut(s) 26
BssECI CCNNGG 2 cut(s) 26, 64
BssMI GATC 1 cut(s) 90
BssT1I CCWWGG 1 cut(s) 26
Bst4CI ACNGT 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 109
BstDSI CCRYGG 2 cut(s) 26, 64
BstENI CCTNNNNNAGG 1 cut(s) 180
BstF5I GGATG 1 cut(s) 93
BstKTI GATC 1 cut(s) 93
BstMBI GATC 1 cut(s) 90
BstNSI RCATGY 1 cut(s) 119
BtgI CCRYGG 2 cut(s) 26, 64
BtsCI GGATG 1 cut(s) 93
Cac8I GCNNGC 1 cut(s) 109
Csp6I GTAC 1 cut(s) 186
CviAII CATG 3 cut(s) 7, 27, 116
CviQI GTAC 1 cut(s) 186
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
Eco130I CCWWGG 1 cut(s) 26
EcoNI CCTNNNNNAGG 1 cut(s) 180
EcoT14I CCWWGG 1 cut(s) 26
ErhI CCWWGG 1 cut(s) 26
FaeI CATG 3 cut(s) 10, 30, 119
FaqI GGGAC 1 cut(s) 180
FatI CATG 3 cut(s) 6, 26, 115
FokI GGATG 1 cut(s) 80
Hin1II CATG 3 cut(s) 10, 30, 119
HinfI GANTC 2 cut(s) 11, 31
HpyAV CCTTC 1 cut(s) 64
HpyCH4III ACNGT 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 74
Hsp92II CATG 3 cut(s) 10, 30, 119
Kzo9I GATC 1 cut(s) 90
LpnPI CCDG 2 cut(s) 147, 168
LweI GCATC 2 cut(s) 61, 131
MaeIII GTNAC 1 cut(s) 85
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MnlI CCTC 1 cut(s) 186
MseI TTAA 1 cut(s) 259
MslI CAYNNNNRTG 1 cut(s) 69
NcoI CCATGG 1 cut(s) 26
NdeII GATC 1 cut(s) 90
NlaIII CATG 3 cut(s) 10, 30, 119
NspI RCATGY 1 cut(s) 119
PciI ACATGT 1 cut(s) 115
PfeI GAWTC 2 cut(s) 11, 31
PscI ACATGT 1 cut(s) 115
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
RseI CAYNNNNRTG 1 cut(s) 69
SaqAI TTAA 1 cut(s) 259
Sau3AI GATC 1 cut(s) 90
SetI ASST 2 cut(s) 56, 187
SfaNI GCATC 2 cut(s) 61, 131
SgeI CNNG 8 cut(s) 19, 39, 77, 120, 128, 174, 195, 222
SmiMI CAYNNNNRTG 1 cut(s) 69
StyI CCWWGG 1 cut(s) 26
TaaI ACNGT 1 cut(s) 130
TfiI GAWTC 2 cut(s) 11, 31
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
TspGWI ACGGA 4 cut(s) 81, 203, 219, 256
XagI CCTNNNNNAGG 1 cut(s) 180
XceI RCATGY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.