Rorug04G0000500

Putative S-adenosyl-L-methionine-dependent methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0000529
Physical Location & Seq
Forward (+)
102340 .. 102591
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0000500.1

Sequence Viewer

Length: 165 bp
ATGCTGCTGAAGTATAGGCCTGAAGACAAAGCAGAGAAGAAGGAGCGTCTTTTGAAAAGGGCTCAGGCAGAGACTGAAGGAAAGACTGTTGAAGCCAAGAAGCCTATTGTTGTGAAGTACGGTCTCAACCATGTCACCTACCTCATTGAGCAGAACAAGGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Methyltransf_29 zf-C3HC4_3

Protein Analysis

54

Amino Acids

6.3

Weight (kDa)

9.65

Isoelectric Point (pI)

29.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000529)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G04430 AT1G04430 AT1G04430 AT3G23300 AT3G23300 AT4G14360 AT4G14360
fragaria_vesca FvH4_2g21260 FvH4_2g21260 FvH4_2g21260 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770 FvH4_4g03770
malus_domestica MD05G1195000.v1.1 MD10G1181600.v1.1 MD10G1182100.v1.1 MD13G1215000.v1.1
prunus_persica Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.1G040400_v2.0.a1 Prupe.8G221700_v2.0.a1 Prupe.8G221700_v2.0.a1 Prupe.8G221700_v2.0.a1
pyrus_communis pycom05g18230 pycom10g15760 pycom10g15770 pycom111g01800
rosa_chinensis RchiOBHm_Chr4g0393501 RchiOBHm_Chr4g0393511 RchiOBHm_Chr4g0393631 RchiOBHm_Chr6g0287841
rosa_laevigata RLG00000009742 RLG00000012463
rosa_multiflora Rmu_sc0001531.1_g000028 Rmu_sc0003877.1_g000004 Rmu_sc0007724.1_g000003 Rmu_sc0008931.1_g000001 Rmu_sc0015036.1_g000004 Rmu_sc0021463.1_g000002 Rmu_sc0023299.1_g000001 Rmu_sc0023300.1_g000001 Rmu_sc0036005.1_g000001
rosa_roxburghii Rroxscaffold_5G00338440 Rroxscaffold_5G00338470 Rroxscaffold_5G00338730 Rroxscaffold_5G00338790 Rroxscaffold_7G00180730 Rroxscaffold_7G00180820
rosa_rugosa Rorug03G0372400 Rorug03G0372500 Rorug03G0372600 Rorug04G0000100 Rorug04G0000200 Rorug04G0000300 Rorug04G0000400 Rorug04G0000500 Rorug04G0000600.1 Rorug04G0000700 Rorug04G0000800 Rorug04G0000900 Rorug06G0192300 Rorug06G0192400 Rorug06G0192500
rosa_samantha Rh4AG047800 Rh4AG048100 Rh4BG043700 Rh4BG044600 Rh4CG050500 Rh4CG050600 Rh4CG050700 Rh4CG051400 Rh4DG045000 Rh4DG045300 Rh6AG302000 Rh6BG307900 Rh6CG301600 Rh6CG315800 Rh6DG300500
rosa_wichuraiana Rw4G003770 Rw4G003800 Rw6G026090

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 3 cut(s) 29, 42, 96
AfaI GTAC 1 cut(s) 119
AgsI TTSAA 2 cut(s) 55, 92
Alw26I GTCTC 2 cut(s) 65, 128
AlwNI CAGNNNCTG 1 cut(s) 74
AoxI GGCC 2 cut(s) 17, 159
ApeKI GCWGC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 127
BanII GRGCYC 1 cut(s) 64
BbsI GAAGAC 1 cut(s) 30
BcoDI GTCTC 2 cut(s) 65, 128
BfaI CTAG 1 cut(s) 163
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
BpiI GAAGAC 1 cut(s) 30
Bpu10I CCTNAGC 1 cut(s) 63
BsaI GGTCTC 1 cut(s) 128
BseMII CTCAG 1 cut(s) 77
BshFI GGCC 2 cut(s) 19, 161
BsmAI GTCTC 2 cut(s) 65, 128
BsnI GGCC 2 cut(s) 19, 161
Bso31I GGTCTC 1 cut(s) 128
Bsp1286I GDGCHC 1 cut(s) 64
BspANI GGCC 2 cut(s) 19, 161
BspCNI CTCAG 1 cut(s) 76
BspTNI GGTCTC 1 cut(s) 128
Bst4CI ACNGT 2 cut(s) 88, 122
BstDEI CTNAG 1 cut(s) 63
BstMAI GTCTC 2 cut(s) 65, 128
BstV2I GAAGAC 1 cut(s) 30
BsuRI GGCC 2 cut(s) 19, 161
CaiI CAGNNNCTG 1 cut(s) 74
CseI GACGC 1 cut(s) 35
Csp6I GTAC 1 cut(s) 118
CviAII CATG 1 cut(s) 131
CviJI RGCY 5 cut(s) 19, 62, 95, 103, 161
CviKI_1 RGCY 5 cut(s) 19, 62, 95, 103, 161
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 1 cut(s) 63
Eco147I AGGCCT 2 cut(s) 19, 161
Eco24I GRGCYC 1 cut(s) 64
Eco31I GGTCTC 1 cut(s) 128
Eco57I CTGAAG 3 cut(s) 29, 42, 96
EcoT38I GRGCYC 1 cut(s) 64
FaeI CATG 1 cut(s) 134
FaiI YATR 2 cut(s) 15, 132
FatI CATG 1 cut(s) 130
Fnu4HI GCNGC 1 cut(s) 5
FriOI GRGCYC 1 cut(s) 64
Fsp4HI GCNGC 1 cut(s) 5
FspBI CTAG 1 cut(s) 163
GluI GCNGC 1 cut(s) 5
HaeIII GGCC 2 cut(s) 19, 161
HgaI GACGC 1 cut(s) 35
Hin1II CATG 1 cut(s) 134
HphI GGTGA 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 34, 71
HpyCH4III ACNGT 2 cut(s) 88, 122
HpyF3I CTNAG 1 cut(s) 63
Hsp92II CATG 1 cut(s) 134
LmnI GCTCC 1 cut(s) 43
LpnPI CCDG 2 cut(s) 33, 50
MaeI CTAG 1 cut(s) 163
MaeIII GTNAC 1 cut(s) 133
MboII GAAGA 2 cut(s) 35, 49
MhlI GDGCHC 1 cut(s) 64
MnlI CCTC 1 cut(s) 152
NlaIII CATG 1 cut(s) 134
NmuCI GTSAC 1 cut(s) 133
PceI AGGCCT 2 cut(s) 19, 161
PkrI GCNGC 1 cut(s) 6
PstNI CAGNNNCTG 1 cut(s) 74
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SatI GCNGC 1 cut(s) 5
SduI GDGCHC 1 cut(s) 64
SetI ASST 2 cut(s) 140, 144
SgeI CNNG 4 cut(s) 32, 77, 109, 143
SseBI AGGCCT 2 cut(s) 19, 161
SspMI CTAG 1 cut(s) 163
StuI AGGCCT 2 cut(s) 19, 161
TaaI ACNGT 2 cut(s) 88, 122
TseFI GTSAC 1 cut(s) 133
TseI GCWGC 1 cut(s) 4
Tsp45I GTSAC 1 cut(s) 133
XspI CTAG 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.