Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002798.1

Orthogroup ID

OG0000803

Physical Location & Seq

Genomic Coordinates Forward (+)

33223 .. 36589

Gene Structure 3367 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002798.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1188 bp

atgtcagacccaaaacccagactagtctgttgcatcggtgacgtccacggcttccacaccaagctccaaaatctctggtccaatctcgaaatctccattccttcttcagacttcgccatcgccctcgtcatcttccttggtgagtactgcggtcgcggcccagacaccaacgaagtccctgacttcttcgtcgtcctcccctccatatacccacatcagatagacgtcttcatcgccggaaaccacgacttagccttcgccgccttcttaagagtcctccctccgccgccggatggatctgaagacagaaaacgtcagagagacgtcttcatcaccggaaaccacgacttagccttcgccgctttcttaggtgtcctgccttcgccgccagacaccaacgaagtccttgacttcttcgtcgttctcccctccatatacccacatcagagagacgtcttcatcgccggaaaccacgacttagccttcgccgctttcttaggtgtcctgccttcgccgccagacaccaacgaagtccttgacttcttcgttgctctcccctccatatacccacgtcagaaagacgtcttcatcgccggaaaccacgacttcgccttcgccgccttcttgaaagtcctgcctccgccgccggatgggtctgagttctgcgaggggtggaaggagttcgaggacagtaaagagagagaaaaagatctggagacagagaaagggcaagaagaagcccatttcgagttctgcaaggaacgcagaaccaccgaaactgacgatggccaccaatcctcgatccaaccaccacctgtcatccaactccgatccgatctttcacctcacatcaagtttctggatattaacctctcctatggccacgaaaccttgccgacaagcaatagatctcaacccagtcaaccaaccattcaaccttacgacatcgaagaagtacagcaacacttgcaaccacacattttcgcagcagaagatagtttctctgtacgagaggttctgtcagctcgatcacagtggcggaggtttcatcttcgccgacgagttttttgtccgtaccggaattcgcagtcaatcctctctctcagttttggctgggtgggagtgattggttctatgcttttccggatttgcgatttttggtatggcagagaaggagatggactatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Metallophos

Protein Analysis

395

Amino Acids

44.77

Weight (kDa)

5.06

Isoelectric Point (pI)

54.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000803)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G09970 AT3G09970
fragaria_vesca	FvH4_6g18140 FvH4_6g18140 FvH4_6g18140 FvH4_6g18140 FvH4_6g18140 FvH4_6g18140
malus_domestica	MD12G1020700.v1.1 MD14G1018000.v1.1
prunus_persica	Prupe.3G199100_v2.0.a1 Prupe.7G115300_v2.0.a1
pyrus_communis	pycom12g01940
rosa_chinensis	RchiOBHm_Chr3g0472431 RchiOBHm_Chr3g0472441
rosa_laevigata	RLG00000021355 RLG00000024079 RLG00000024080
rosa_multiflora	Rmu_sc0000035.1_g000007 Rmu_sc0000058.1_g000003 Rmu_sc0000311.1_g000014 Rmu_sc0000617.1_g000041 Rmu_sc0000820.1_g000023 Rmu_sc0001096.1_g000016 Rmu_sc0001096.1_g000023 Rmu_sc0001488.1_g000014 Rmu_sc0002798.1_g000005 Rmu_sc0003363.1_g000076 Rmu_sc0004185.1_g000006 Rmu_sc0004790.1_g000009 Rmu_sc0004941.1_g000015 Rmu_sc0006705.1_g000013 Rmu_sc0013245.1_g000014 Rmu_sc0018288.1_g000001 Rmu_sc0018288.1_g000003
rosa_roxburghii	Rroxscaffold_6G00408910 Rroxscaffold_6G00408920
rosa_rugosa	Rorug03G0125000 Rorug03G0125100 Rorug03G0125200 Rorug03G0125300 Rorug05G0556700
rosa_samantha	Rh1AG050800 Rh2AG267200 Rh2DG188700 Rh2DG274200 Rh3AG053900 Rh3AG177300 Rh3AG177400 Rh3AG244900 Rh3BG203200 Rh3BG203300 Rh3CG193600 Rh3CG193700 Rh3CG200700 Rh3CG200800 Rh3DG055900 Rh3DG171800 Rh3DG171900 Rh4CG267100 Rh4DG237500 Rh5BG060700 Rh6BG122000 Rh6CG120200 Rh6DG108000 Rh7AG396900 Rh7BG062000
rosa_wichuraiana	Rw3G016420 Rw3G016430

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	188, 416
AatII	GACGTC	5 cut(s)	45, 228, 327, 456, 585
AccII	CGCG	1 cut(s)	156
AccIII	TCCGGA	1 cut(s)	1143
AclWI	GGATC	3 cut(s)	304, 796, 825
AcoI	YGGCCR	2 cut(s)	787, 880
AcsI	RAATTY	1 cut(s)	1081
AcuI	CTGAAG	2 cut(s)	90, 321
AcyI	GRCGYC	5 cut(s)	42, 225, 324, 453, 582
AfaI	GTAC	4 cut(s)	146, 957, 1008, 1076
AfiI	CCNNNNNNNGG	2 cut(s)	293, 650
AflII	CTTAAG	1 cut(s)	268
AgsI	TTSAA	2 cut(s)	628, 935
AhlI	ACTAGT	1 cut(s)	22
AjiI	CACGTC	1 cut(s)	572
AluBI	AGCT	2 cut(s)	64, 1025
AluI	AGCT	2 cut(s)	64, 1025
Alw26I	GTCTC	3 cut(s)	315, 444, 710
AlwI	GGATC	3 cut(s)	304, 796, 825
Aor13HI	TCCGGA	1 cut(s)	1143
AoxI	GGCC	3 cut(s)	157, 787, 880
ApeKI	GCWGC	1 cut(s)	986
ApoI	RAATTY	1 cut(s)	1081
Asp700I	GAANNNNTTC	1 cut(s)	680
AspS9I	GGNCC	2 cut(s)	78, 158
AsuHPI	GGTGA	4 cut(s)	50, 152, 325, 834
AvaII	GGWCC	1 cut(s)	78
BalI	TGGCCA	2 cut(s)	789, 882
BbsI	GAAGAC	5 cut(s)	220, 309, 319, 448, 577
BbvI	GCAGC	1 cut(s)	998
BccI	CCATC	5 cut(s)	125, 287, 644, 779, 1172
BceAI	ACGGC	1 cut(s)	64
BcoDI	GTCTC	3 cut(s)	315, 444, 710
BcuI	ACTAGT	1 cut(s)	22
BfaI	CTAG	1 cut(s)	23
BfmI	CTRYAG	1 cut(s)	1184
BfrI	CTTAAG	1 cut(s)	268
BglII	AGATCT	2 cut(s)	709, 908
BmcAI	AGTACT	1 cut(s)	146
Bme18I	GGWCC	1 cut(s)	78
BmgBI	CACGTC	1 cut(s)	572
BmgT120I	GGNCC	2 cut(s)	78, 158
BmrI	ACTGGG	1 cut(s)	912
BmsI	GCATC	1 cut(s)	42
BmuI	ACTGGG	1 cut(s)	912
BpiI	GAAGAC	5 cut(s)	220, 309, 319, 448, 577
BpmI	CTGGAG	1 cut(s)	734
BsaHI	GRCGYC	5 cut(s)	42, 225, 324, 453, 582
BsaJI	CCNNGG	2 cut(s)	46, 136
BsaWI	WCCGGW	3 cut(s)	335, 1077, 1143
Bsc4I	CCNNNNNNNGG	2 cut(s)	293, 650
Bse1I	ACTGG	1 cut(s)	918
BseAI	TCCGGA	1 cut(s)	1143
BseDI	CCNNGG	2 cut(s)	46, 136
BseGI	GGATG	3 cut(s)	298, 655, 819
BseLI	CCNNNNNNNGG	2 cut(s)	293, 650
BseMII	CTCAG	2 cut(s)	648, 1117
BseNI	ACTGG	1 cut(s)	918
BseXI	GCAGC	1 cut(s)	998
BseYI	CCCAGC	1 cut(s)	1113
Bsh1236I	CGCG	1 cut(s)	156
Bsh1285I	CGRYCG	1 cut(s)	154
BshFI	GGCC	3 cut(s)	159, 789, 882
BsiEI	CGRYCG	1 cut(s)	154
BsiSI	CCGG	8 cut(s)	237, 290, 336, 465, 594, 647, 1078, 1144
BslFI	GGGAC	1 cut(s)	161
BslI	CCNNNNNNNGG	2 cut(s)	293, 650
BsmAI	GTCTC	3 cut(s)	315, 444, 710
BsmBI	CGTCTC	2 cut(s)	315, 444
BsmFI	GGGAC	1 cut(s)	161
BsnI	GGCC	3 cut(s)	159, 789, 882
Bsp13I	TCCGGA	1 cut(s)	1143
Bsp143I	GATC	7 cut(s)	296, 709, 801, 830, 835, 908, 1028
BspANI	GGCC	3 cut(s)	159, 789, 882
BspCNI	CTCAG	2 cut(s)	649, 1116
BspEI	TCCGGA	1 cut(s)	1143
BspFNI	CGCG	1 cut(s)	156
BspPI	GGATC	3 cut(s)	304, 796, 825
BspTI	CTTAAG	1 cut(s)	268
BsrI	ACTGG	1 cut(s)	918
BssECI	CCNNGG	2 cut(s)	46, 136
BssMI	GATC	7 cut(s)	296, 709, 801, 830, 835, 908, 1028
BssNI	GRCGYC	5 cut(s)	42, 225, 324, 453, 582
BssT1I	CCWWGG	1 cut(s)	136
Bst4CI	ACNGT	2 cut(s)	692, 1035
BstACI	GRCGYC	5 cut(s)	42, 225, 324, 453, 582
BstAFI	CTTAAG	1 cut(s)	268
BstAPI	GCANNNNNTGC	1 cut(s)	967
BstDEI	CTNAG	7 cut(s)	250, 349, 367, 478, 496, 657, 1103
BstDSI	CCRYGG	1 cut(s)	46
BstF5I	GGATG	3 cut(s)	298, 655, 819
BstFNI	CGCG	1 cut(s)	156
BstKTI	GATC	7 cut(s)	299, 712, 804, 833, 838, 911, 1031
BstMAI	GTCTC	3 cut(s)	315, 444, 710
BstMBI	GATC	7 cut(s)	296, 709, 801, 830, 835, 908, 1028
BstMCI	CGRYCG	1 cut(s)	154
BstSFI	CTRYAG	1 cut(s)	1184
BstUI	CGCG	1 cut(s)	156
BstV1I	GCAGC	1 cut(s)	998
BstV2I	GAAGAC	5 cut(s)	220, 309, 319, 448, 577
BstX2I	RGATCY	3 cut(s)	296, 709, 908
BstYI	RGATCY	3 cut(s)	296, 709, 908
BsuRI	GGCC	3 cut(s)	159, 789, 882
BtgI	CCRYGG	1 cut(s)	46
BtgZI	GCGATG	4 cut(s)	103, 217, 445, 574
BtrI	CACGTC	1 cut(s)	572
BtsCI	GGATG	3 cut(s)	298, 655, 819
BtsIMutI	CAGTG	1 cut(s)	1040
Cfr13I	GGNCC	2 cut(s)	78, 158
Csp6I	GTAC	4 cut(s)	145, 956, 1007, 1075
CviQI	GTAC	4 cut(s)	145, 956, 1007, 1075
DdeI	CTNAG	7 cut(s)	250, 349, 367, 478, 496, 657, 1103
DpnI	GATC	7 cut(s)	298, 711, 803, 832, 837, 910, 1030
DpnII	GATC	7 cut(s)	296, 709, 801, 830, 835, 908, 1028
DrdI	GACNNNNNNGTC	2 cut(s)	188, 416
DseDI	GACNNNNNNGTC	2 cut(s)	188, 416
EaeI	YGGCCR	2 cut(s)	787, 880
EciI	GGCGGA	3 cut(s)	273, 630, 1054
Eco130I	CCWWGG	1 cut(s)	136
Eco47I	GGWCC	1 cut(s)	78
Eco57I	CTGAAG	2 cut(s)	90, 321
EcoRI	GAATTC	1 cut(s)	1081
EcoT14I	CCWWGG	1 cut(s)	136
ErhI	CCWWGG	1 cut(s)	136
Esp3I	CGTCTC	2 cut(s)	315, 444
FaqI	GGGAC	1 cut(s)	161
FokI	GGATG	3 cut(s)	305, 662, 806
FspBI	CTAG	1 cut(s)	23
GsaI	CCCAGC	1 cut(s)	1117
GsuI	CTGGAG	1 cut(s)	734
HaeIII	GGCC	3 cut(s)	159, 789, 882
HapII	CCGG	8 cut(s)	237, 290, 336, 465, 594, 647, 1078, 1144
Hin1I	GRCGYC	5 cut(s)	42, 225, 324, 453, 582
HincII	GTYRAC	1 cut(s)	923
HindII	GTYRAC	1 cut(s)	923
HinfI	GANTC	1 cut(s)	273
HpaII	CCGG	8 cut(s)	237, 290, 336, 465, 594, 647, 1078, 1144
HphI	GGTGA	4 cut(s)	50, 152, 325, 834
Hpy166II	GTNNAC	2 cut(s)	46, 923
Hpy188III	TCNNGA	5 cut(s)	86, 625, 713, 860, 1144
Hpy8I	GTNNAC	2 cut(s)	46, 923
Hpy99I	CGWCG	3 cut(s)	194, 422, 1062
HpyCH4III	ACNGT	2 cut(s)	692, 1035
HpyCH4IV	ACGT	7 cut(s)	42, 225, 313, 324, 453, 571, 582
HpyCH4V	TGCA	3 cut(s)	33, 756, 970
HpyF3I	CTNAG	7 cut(s)	250, 349, 367, 478, 496, 657, 1103
HpySE526I	ACGT	7 cut(s)	42, 225, 313, 324, 453, 571, 582
Hsp92I	GRCGYC	5 cut(s)	42, 225, 324, 453, 582
Kpn2I	TCCGGA	1 cut(s)	1143
Kzo9I	GATC	7 cut(s)	296, 709, 801, 830, 835, 908, 1028
LmnI	GCTCC	1 cut(s)	69
Lsp1109I	GCAGC	1 cut(s)	998
LweI	GCATC	1 cut(s)	42
MaeI	CTAG	1 cut(s)	23
MaeII	ACGT	7 cut(s)	42, 225, 313, 324, 453, 571, 582
MaeIII	GTNAC	1 cut(s)	38
MalI	GATC	7 cut(s)	298, 711, 803, 832, 837, 910, 1030
MboI	GATC	7 cut(s)	296, 709, 801, 830, 835, 908, 1028
MflI	RGATCY	3 cut(s)	296, 709, 908
MlsI	TGGCCA	2 cut(s)	789, 882
MluCI	AATT	1 cut(s)	1081
MluNI	TGGCCA	2 cut(s)	789, 882
MlyI	GAGTC	1 cut(s)	282
MmeI	TCCRAC	2 cut(s)	829, 847
Mox20I	TGGCCA	2 cut(s)	789, 882
MroI	TCCGGA	1 cut(s)	1143
MroXI	GAANNNNTTC	1 cut(s)	680
MscI	TGGCCA	2 cut(s)	789, 882
MseI	TTAA	2 cut(s)	269, 867
Msp20I	TGGCCA	2 cut(s)	789, 882
MspCI	CTTAAG	1 cut(s)	268
MspI	CCGG	8 cut(s)	237, 290, 336, 465, 594, 647, 1078, 1144
MvnI	CGCG	1 cut(s)	156
NdeII	GATC	7 cut(s)	296, 709, 801, 830, 835, 908, 1028
NmuCI	GTSAC	1 cut(s)	38
PdmI	GAANNNNTTC	1 cut(s)	680
PleI	GAGTC	1 cut(s)	281
PpsI	GAGTC	1 cut(s)	281
PspFI	CCCAGC	1 cut(s)	1113
PspPI	GGNCC	2 cut(s)	78, 158
PsrI	GAACNNNNNNTAC	2 cut(s)	999, 1031
PsuI	RGATCY	3 cut(s)	296, 709, 908
RsaI	GTAC	4 cut(s)	146, 957, 1008, 1076
RsaNI	GTAC	4 cut(s)	145, 956, 1007, 1075
SaqAI	TTAA	2 cut(s)	269, 867
Sau3AI	GATC	7 cut(s)	296, 709, 801, 830, 835, 908, 1028
Sau96I	GGNCC	2 cut(s)	78, 158
ScaI	AGTACT	1 cut(s)	146
SchI	GAGTC	1 cut(s)	282
SfaNI	GCATC	1 cut(s)	42
SfcI	CTRYAG	1 cut(s)	1184
SinI	GGWCC	1 cut(s)	78
SmlI	CTYRAG	1 cut(s)	268
SmoI	CTYRAG	1 cut(s)	268
SpeI	ACTAGT	1 cut(s)	22
Sse9I	AATT	1 cut(s)	1081
SspMI	CTAG	1 cut(s)	23
StyI	CCWWGG	1 cut(s)	136
TaaI	ACNGT	2 cut(s)	692, 1035
TaiI	ACGT	7 cut(s)	45, 228, 316, 327, 456, 574, 585
TaqI	TCGA	6 cut(s)	87, 684, 747, 800, 948, 1027
TasI	AATT	1 cut(s)	1081
TatI	WGTACW	2 cut(s)	144, 955
TauI	GCSGC	9 cut(s)	159, 263, 289, 362, 388, 491, 517, 620, 646
Tru1I	TTAA	2 cut(s)	269, 867
Tru9I	TTAA	2 cut(s)	269, 867
TscAI	CASTG	1 cut(s)	1040
TseFI	GTSAC	1 cut(s)	38
TseI	GCWGC	1 cut(s)	986
Tsp45I	GTSAC	1 cut(s)	38
TspDTI	ATGAA	5 cut(s)	220, 319, 448, 577, 1037
TspGWI	ACGGA	1 cut(s)	1062
TspRI	CASTG	1 cut(s)	1040
Vha464I	CTTAAG	1 cut(s)	268
VpaK11BI	GGWCC	1 cut(s)	78
XapI	RAATTY	1 cut(s)	1081
XmnI	GAANNNNTTC	1 cut(s)	680
XspI	CTAG	1 cut(s)	23
ZraI	GACGTC	5 cut(s)	43, 226, 325, 454, 583
ZrmI	AGTACT	1 cut(s)	146

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.