Rmu_sc0017540.1_g000001

germin-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017540.1
Physical Location & Seq
Reverse (-)
3063 .. 3626
564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017540.1_g000001.1.cds

Sequence Viewer

Length: 564 bp
atgcattttggacataatcaaatatcagtactagtgaatggacatgtgtgcaaggaccccaagctagttgtcgccgatgacttcttcttcagtggacttcacctagcaggcaacacatcaaaccctgccggttcacgtgtgacccctgcaaacgtagcccagattccaggacttaatactcttggtatctcccttgttcgtatcgactatgcaccatggggcatcaatgctccacacactcatcctagagccactgaagtcctaacagtcctagaagggagcctccaagtgggttttgtcacctccaaccctgaaaacagacttatcacaaaggtgcttcagaagggcgatgtgtttgtgttcccagtaggacttgtgcatttccagcacaatgttggaaatgttaatgcggtcgccattgcagctctgagcagccaaaatccaggtgctattaccattgccaatgcagtgtttggatcaaagcctgccatttctgctgatgttcttgcgaaggcattccaagtcgacaaggacacaatctacgatttccagtccaagttctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

187

Amino Acids

19.88

Weight (kDa)

7.1

Isoelectric Point (pI)

19.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 525
AciI CCGC 1 cut(s) 410
AclWI GGATC 1 cut(s) 484
AcuI CTGAAG 3 cut(s) 73, 276, 323
AcvI CACGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 30
AfiI CCNNNNNNNGG 1 cut(s) 289
AflIII ACRYGT 2 cut(s) 43, 136
AhlI ACTAGT 1 cut(s) 31
AjnI CCWGG 2 cut(s) 166, 442
AleI CACNNNNGTG 1 cut(s) 332
AluBI AGCT 2 cut(s) 64, 425
AluI AGCT 2 cut(s) 64, 425
AlwI GGATC 1 cut(s) 484
ApeKI GCWGC 2 cut(s) 422, 432
Asp700I GAANNNNTTC 1 cut(s) 515
AspS9I GGNCC 1 cut(s) 55
AsuHPI GGTGA 2 cut(s) 92, 292
AvaII GGWCC 1 cut(s) 55
BbrPI CACGTG 1 cut(s) 137
BbvI GCAGC 2 cut(s) 434, 444
BciT130I CCWGG 2 cut(s) 168, 444
BcuI ACTAGT 1 cut(s) 31
BfaI CTAG 6 cut(s) 32, 65, 104, 246, 272, 562
BisI GCNGC 2 cut(s) 423, 433
BlsI GCNGC 2 cut(s) 424, 434
BmcAI AGTACT 1 cut(s) 30
Bme1390I CCNGG 2 cut(s) 168, 444
Bme18I GGWCC 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 55
BmiI GGNNCC 2 cut(s) 57, 281
BmrFI CCNGG 2 cut(s) 168, 444
BmrI ACTGGG 1 cut(s) 359
BmsI GCATC 1 cut(s) 231
BmuI ACTGGG 1 cut(s) 359
BsaAI YACGTR 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 215
Bsc4I CCNNNNNNNGG 1 cut(s) 289
Bse118I RCCGGY 1 cut(s) 128
Bse1I ACTGG 2 cut(s) 365, 550
Bse3DI GCAATG 2 cut(s) 417, 456
BseBI CCWGG 2 cut(s) 168, 444
BseDI CCNNGG 1 cut(s) 215
BseGI GGATG 1 cut(s) 241
BseLI CCNNNNNNNGG 1 cut(s) 289
BseMI GCAATG 2 cut(s) 417, 456
BseMII CTCAG 1 cut(s) 419
BseNI ACTGG 2 cut(s) 365, 550
BseXI GCAGC 2 cut(s) 434, 444
Bsh1285I CGRYCG 1 cut(s) 414
BsiEI CGRYCG 1 cut(s) 414
BsiSI CCGG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 289
BsmI GAATGC 1 cut(s) 515
Bsp143I GATC 1 cut(s) 476
Bsp19I CCATGG 1 cut(s) 215
BspACI CCGC 1 cut(s) 410
BspCNI CTCAG 1 cut(s) 420
BspLI GGNNCC 2 cut(s) 57, 281
BspPI GGATC 1 cut(s) 484
BsrDI GCAATG 2 cut(s) 417, 456
BsrFI RCCGGY 1 cut(s) 128
BsrI ACTGG 2 cut(s) 365, 550
BssAI RCCGGY 1 cut(s) 128
BssECI CCNNGG 1 cut(s) 215
BssMI GATC 1 cut(s) 476
BssT1I CCWWGG 1 cut(s) 215
Bst2UI CCWGG 2 cut(s) 168, 444
Bst4CI ACNGT 1 cut(s) 268
BstBAI YACGTR 1 cut(s) 137
BstC8I GCNNGC 2 cut(s) 109, 486
BstDEI CTNAG 1 cut(s) 428
BstDSI CCRYGG 1 cut(s) 215
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 1 cut(s) 479
BstMBI GATC 1 cut(s) 476
BstMCI CGRYCG 1 cut(s) 414
BstMWI GCNNNNNNNGC 4 cut(s) 155, 385, 422, 494
BstNI CCWGG 2 cut(s) 168, 444
BstNSI RCATGY 1 cut(s) 47
BstSCI CCNGG 2 cut(s) 166, 442
BstV1I GCAGC 2 cut(s) 434, 444
BtgI CCRYGG 1 cut(s) 215
BtgZI GCGATG 1 cut(s) 363
BtsCI GGATG 1 cut(s) 241
BtsI GCAGTG 1 cut(s) 474
BtsIMutI CAGTG 3 cut(s) 97, 252, 474
Cac8I GCNNGC 2 cut(s) 109, 486
Cfr10I RCCGGY 1 cut(s) 128
Cfr13I GGNCC 1 cut(s) 55
Csp6I GTAC 1 cut(s) 29
CviAII CATG 2 cut(s) 44, 216
CviJI RGCY 7 cut(s) 64, 158, 251, 282, 425, 435, 484
CviKI_1 RGCY 7 cut(s) 64, 158, 251, 282, 425, 435, 484
CviQI GTAC 1 cut(s) 29
DdeI CTNAG 1 cut(s) 428
DpnI GATC 1 cut(s) 478
DpnII GATC 1 cut(s) 476
Eco130I CCWWGG 1 cut(s) 215
Eco47I GGWCC 1 cut(s) 55
Eco57I CTGAAG 3 cut(s) 73, 276, 323
Eco72I CACGTG 1 cut(s) 137
EcoO109I RGGNCCY 1 cut(s) 55
EcoRII CCWGG 2 cut(s) 166, 442
EcoT14I CCWWGG 1 cut(s) 215
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 215
FaeI CATG 2 cut(s) 47, 219
FaiI YATR 4 cut(s) 15, 45, 210, 217
FatI CATG 2 cut(s) 43, 215
FblI GTMKAC 1 cut(s) 525
Fnu4HI GCNGC 2 cut(s) 423, 433
FokI GGATG 1 cut(s) 228
Fsp4HI GCNGC 2 cut(s) 423, 433
FspBI CTAG 6 cut(s) 32, 65, 104, 246, 272, 562
GluI GCNGC 2 cut(s) 423, 433
HapII CCGG 1 cut(s) 129
Hin1II CATG 2 cut(s) 47, 219
HincII GTYRAC 1 cut(s) 526
HindII GTYRAC 1 cut(s) 526
HinfI GANTC 1 cut(s) 163
HpaII CCGG 1 cut(s) 129
HphI GGTGA 2 cut(s) 92, 292
Hpy166II GTNNAC 3 cut(s) 95, 134, 526
Hpy188I TCNGA 2 cut(s) 342, 429
Hpy8I GTNNAC 3 cut(s) 95, 134, 526
HpyAV CCTTC 3 cut(s) 269, 337, 505
HpyCH4III ACNGT 1 cut(s) 268
HpyCH4IV ACGT 2 cut(s) 136, 153
HpyCH4V TGCA 7 cut(s) 4, 51, 149, 212, 379, 422, 467
HpyF10VI GCNNNNNNNGC 4 cut(s) 155, 385, 422, 494
HpyF3I CTNAG 1 cut(s) 428
HpySE526I ACGT 2 cut(s) 136, 153
Hsp92II CATG 2 cut(s) 47, 219
Kzo9I GATC 1 cut(s) 476
LmnI GCTCC 2 cut(s) 235, 279
Lsp1109I GCAGC 2 cut(s) 434, 444
LweI GCATC 1 cut(s) 231
MaeI CTAG 6 cut(s) 32, 65, 104, 246, 272, 562
MaeII ACGT 2 cut(s) 136, 153
MaeIII GTNAC 2 cut(s) 139, 298
MalI GATC 1 cut(s) 478
MboI GATC 1 cut(s) 476
MboII GAAGA 2 cut(s) 76, 79
MmeI TCCRAC 2 cut(s) 330, 376
MnlI CCTC 2 cut(s) 293, 313
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 1 cut(s) 515
MseI TTAA 2 cut(s) 174, 405
MslI CAYNNNNRTG 1 cut(s) 332
MspI CCGG 1 cut(s) 129
MspR9I CCNGG 2 cut(s) 168, 444
Mva1269I GAATGC 1 cut(s) 515
MvaI CCWGG 2 cut(s) 168, 444
MwoI GCNNNNNNNGC 4 cut(s) 155, 385, 422, 494
NcoI CCATGG 1 cut(s) 215
NdeII GATC 1 cut(s) 476
NlaIII CATG 2 cut(s) 47, 219
NlaIV GGNNCC 2 cut(s) 57, 281
NmuCI GTSAC 2 cut(s) 139, 298
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 47
OliI CACNNNNGTG 1 cut(s) 332
PciI ACATGT 1 cut(s) 43
PctI GAATGC 1 cut(s) 515
PdmI GAANNNNTTC 1 cut(s) 515
PfeI GAWTC 1 cut(s) 163
PfoI TCCNGGA 1 cut(s) 166
PkrI GCNGC 2 cut(s) 424, 434
PmaCI CACGTG 1 cut(s) 137
PmlI CACGTG 1 cut(s) 137
Ppu21I YACGTR 1 cut(s) 137
PpuMI RGGWCCY 1 cut(s) 55
PscI ACATGT 1 cut(s) 43
Psp5II RGGWCCY 1 cut(s) 55
Psp6I CCWGG 2 cut(s) 166, 442
PspCI CACGTG 1 cut(s) 137
PspGI CCWGG 2 cut(s) 166, 442
PspN4I GGNNCC 2 cut(s) 57, 281
PspPI GGNCC 1 cut(s) 55
PspPPI RGGWCCY 1 cut(s) 55
RsaI GTAC 1 cut(s) 30
RsaNI GTAC 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 332
SalI GTCGAC 1 cut(s) 524
SaqAI TTAA 2 cut(s) 174, 405
SatI GCNGC 2 cut(s) 423, 433
Sau3AI GATC 1 cut(s) 476
Sau96I GGNCC 1 cut(s) 55
ScaI AGTACT 1 cut(s) 30
ScrFI CCNGG 2 cut(s) 168, 444
SetI ASST 8 cut(s) 66, 105, 139, 156, 305, 336, 427, 448
SfaNI GCATC 1 cut(s) 231
SinI GGWCC 1 cut(s) 55
SmiMI CAYNNNNRTG 1 cut(s) 332
SpeI ACTAGT 1 cut(s) 31
SsiI CCGC 1 cut(s) 410
SspMI CTAG 6 cut(s) 32, 65, 104, 246, 272, 562
StyD4I CCNGG 2 cut(s) 166, 442
StyI CCWWGG 1 cut(s) 215
TaaI ACNGT 1 cut(s) 268
TaiI ACGT 2 cut(s) 139, 156
TaqI TCGA 2 cut(s) 204, 525
TatI WGTACW 1 cut(s) 28
TfiI GAWTC 1 cut(s) 163
Tru1I TTAA 2 cut(s) 174, 405
Tru9I TTAA 2 cut(s) 174, 405
TscAI CASTG 3 cut(s) 97, 259, 474
TseFI GTSAC 2 cut(s) 139, 298
TseI GCWGC 2 cut(s) 422, 432
Tsp45I GTSAC 2 cut(s) 139, 298
TspRI CASTG 3 cut(s) 97, 259, 474
VpaK11BI GGWCC 1 cut(s) 55
XceI RCATGY 1 cut(s) 47
XcmI CCANNNNNNNNNTGG 1 cut(s) 392
XmiI GTMKAC 1 cut(s) 525
XmnI GAANNNNTTC 1 cut(s) 515
XspI CTAG 6 cut(s) 32, 65, 104, 246, 272, 562
ZrmI AGTACT 1 cut(s) 30
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.