Rroxscaffold_2G00129370

calmodulin-binding transcription activator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001204
Physical Location & Seq
Forward (+)
65206997 .. 65208001
1005 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00129370.1

Sequence Viewer

Length: 306 bp
ATGGCAGAGAGCAATCCGTACGGTCCTGGAGAAAAAATGAATGCAGATGGTCAGCAAGTACTCTCACGAGTACATGATCGATGGCTACGTCCCGATGAAATCTGTAAAATTCTTCGTAATCATAAATTGTTCGCTATTTCTCAGAAGGCAGAAAATATGCCACAGAGTGGATCGCTTTTTCTTTTTGATCGAAACGTGGTGAGGCGTTTCAGAAAAGATGGTTATAGGTGGAAGAAGGCAAAAGATGGAAAGACGGTGAAGGAAGGACATGAGAAGCTCAAGGTATGTACATATTCAAGTTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 CG-1 IQ TIG

Protein Analysis

101

Amino Acids

11.8

Weight (kDa)

9.85

Isoelectric Point (pI)

57.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CG-1 PF03859 25 - 96 9.8e-27 CG-1 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 167
AclWI GGATC 1 cut(s) 178
AcsI RAATTY 1 cut(s) 108
AdeI CACNNNGTG 1 cut(s) 167
AfaI GTAC 4 cut(s) 20, 60, 72, 289
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 1 cut(s) 297
AjnI CCWGG 1 cut(s) 25
AluBI AGCT 1 cut(s) 277
AluI AGCT 1 cut(s) 277
AlwI GGATC 1 cut(s) 178
ApoI RAATTY 1 cut(s) 108
AspS9I GGNCC 1 cut(s) 23
AsuHPI GGTGA 2 cut(s) 211, 268
AvaII GGWCC 1 cut(s) 23
BauI CACGAG 1 cut(s) 66
BccI CCATC 4 cut(s) 41, 75, 212, 239
BciT130I CCWGG 1 cut(s) 27
BmcAI AGTACT 1 cut(s) 60
Bme1390I CCNGG 1 cut(s) 27
Bme18I GGWCC 1 cut(s) 23
BmgT120I GGNCC 1 cut(s) 23
BmrFI CCNGG 1 cut(s) 27
BpmI CTGGAG 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 263
Bsa29I ATCGAT 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 167
BseBI CCWGG 1 cut(s) 27
BseCI ATCGAT 1 cut(s) 79
BseLI CCNNNNNNNGG 1 cut(s) 167
BseMII CTCAG 1 cut(s) 155
BshVI ATCGAT 1 cut(s) 79
BsiWI CGTACG 1 cut(s) 18
BslFI GGGAC 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 167
BsmFI GGGAC 1 cut(s) 75
BsmI GAATGC 1 cut(s) 46
Bsp1407I TGTACA 1 cut(s) 287
Bsp143I GATC 3 cut(s) 76, 170, 187
BspCNI CTCAG 1 cut(s) 154
BspDI ATCGAT 1 cut(s) 79
BspPI GGATC 1 cut(s) 178
BsrGI TGTACA 1 cut(s) 287
BssMI GATC 3 cut(s) 76, 170, 187
BssSI CACGAG 1 cut(s) 66
Bst2BI CACGAG 1 cut(s) 66
Bst2UI CCWGG 1 cut(s) 27
Bst4CI ACNGT 2 cut(s) 23, 256
BstAUI TGTACA 1 cut(s) 287
BstDEI CTNAG 1 cut(s) 141
BstKTI GATC 3 cut(s) 79, 173, 190
BstMBI GATC 3 cut(s) 76, 170, 187
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 1 cut(s) 25
Bsu15I ATCGAT 1 cut(s) 79
BsuTUI ATCGAT 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 23
ClaI ATCGAT 1 cut(s) 79
Csp6I GTAC 4 cut(s) 19, 59, 71, 288
CviAII CATG 2 cut(s) 74, 269
CviJI RGCY 2 cut(s) 85, 277
CviKI_1 RGCY 2 cut(s) 85, 277
CviQI GTAC 4 cut(s) 19, 59, 71, 288
DdeI CTNAG 1 cut(s) 141
DpnI GATC 3 cut(s) 78, 172, 189
DpnII GATC 3 cut(s) 76, 170, 187
DraIII CACNNNGTG 1 cut(s) 167
Eco47I GGWCC 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 25
FaeI CATG 2 cut(s) 77, 272
FaiI YATR 7 cut(s) 75, 123, 158, 225, 270, 286, 292
FaqI GGGAC 1 cut(s) 75
FatI CATG 2 cut(s) 73, 268
GsuI CTGGAG 1 cut(s) 48
Hin1II CATG 2 cut(s) 77, 272
HphI GGTGA 2 cut(s) 211, 268
Hpy188I TCNGA 2 cut(s) 144, 212
Hpy188III TCNNGA 2 cut(s) 66, 92
HpyAV CCTTC 4 cut(s) 139, 229, 253, 257
HpyCH4III ACNGT 2 cut(s) 23, 256
HpyCH4IV ACGT 2 cut(s) 88, 195
HpyCH4V TGCA 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 141
HpySE526I ACGT 2 cut(s) 88, 195
Hsp92II CATG 2 cut(s) 77, 272
Kzo9I GATC 3 cut(s) 76, 170, 187
LpnPI CCDG 2 cut(s) 12, 39
MaeII ACGT 2 cut(s) 88, 195
MalI GATC 3 cut(s) 78, 172, 189
MboI GATC 3 cut(s) 76, 170, 187
MboII GAAGA 2 cut(s) 104, 244
MluCI AATT 2 cut(s) 108, 125
MnlI CCTC 1 cut(s) 195
MspR9I CCNGG 1 cut(s) 27
Mva1269I GAATGC 1 cut(s) 46
MvaI CCWGG 1 cut(s) 27
NdeII GATC 3 cut(s) 76, 170, 187
NlaIII CATG 2 cut(s) 77, 272
PcsI WCGNNNNNNNCGW 1 cut(s) 85
PctI GAATGC 1 cut(s) 46
Pfl23II CGTACG 1 cut(s) 18
PflMI CCANNNNNTGG 1 cut(s) 167
PfoI TCCNGGA 1 cut(s) 25
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspLI CGTACG 1 cut(s) 18
PspPI GGNCC 1 cut(s) 23
RsaI GTAC 4 cut(s) 20, 60, 72, 289
RsaNI GTAC 4 cut(s) 19, 59, 71, 288
Sau3AI GATC 3 cut(s) 76, 170, 187
Sau96I GGNCC 1 cut(s) 23
ScaI AGTACT 1 cut(s) 60
ScrFI CCNGG 1 cut(s) 27
SetI ASST 5 cut(s) 91, 198, 230, 279, 285
SinI GGWCC 1 cut(s) 23
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
Sse9I AATT 2 cut(s) 108, 125
StyD4I CCNGG 1 cut(s) 25
TaaI ACNGT 2 cut(s) 23, 256
TaiI ACGT 2 cut(s) 91, 198
TaqI TCGA 2 cut(s) 79, 190
TasI AATT 2 cut(s) 108, 125
TatI WGTACW 3 cut(s) 58, 70, 287
TspDTI ATGAA 2 cut(s) 53, 111
TspGWI ACGGA 1 cut(s) 6
Van91I CCANNNNNTGG 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 23
XapI RAATTY 1 cut(s) 108
ZrmI AGTACT 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.