Rh5AG518400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0001204
Physical Location & Seq
Reverse (-)
88221054 .. 88222109
1056 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG518400.1

Sequence Viewer

Length: 245 bp
ATGGACGAAACCATTAGATCCGGTGATGATGCTCAATCTCTAACTAACCTGATAGCTTCTCGGTCTCATCGACCTCACCTACTGCTCCGCTCAGTATCTCCGGCAACGATCCGATTGGCTTCTCTTTGCCGAATAGAGGTAGTCCCAGTTACATTGGCTGGTCTAATTCCTCTAGAGCTTTGTGGTTGCTCTGAAGATGGAAGGAGGTCAGCACTCCAAGATGCATTGCTCTTCCGTTCACCAAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.78

Weight (kDa)

6.7

Isoelectric Point (pI)

87.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 90
AciI CCGC 1 cut(s) 88
AclWI GGATC 2 cut(s) 12, 103
AcuI CTGAAG 1 cut(s) 213
AfiI CCNNNNNNNGG 1 cut(s) 136
AluBI AGCT 2 cut(s) 56, 178
AluI AGCT 2 cut(s) 56, 178
Alw26I GTCTC 1 cut(s) 69
AlwI GGATC 2 cut(s) 12, 103
AsuHPI GGTGA 3 cut(s) 35, 68, 231
BccI CCATC 1 cut(s) 191
BcoDI GTCTC 1 cut(s) 69
BfaI CTAG 1 cut(s) 173
BmrI ACTGGG 1 cut(s) 140
BmsI GCATC 2 cut(s) 19, 211
BmuI ACTGGG 1 cut(s) 140
BsaI GGTCTC 1 cut(s) 69
BsaWI WCCGGW 1 cut(s) 20
Bsc4I CCNNNNNNNGG 1 cut(s) 136
Bse1I ACTGG 1 cut(s) 146
Bse3DI GCAATG 1 cut(s) 224
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 224
BseMII CTCAG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 146
BsiSI CCGG 2 cut(s) 21, 101
BslFI GGGAC 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 136
BsmAI GTCTC 1 cut(s) 69
BsmFI GGGAC 1 cut(s) 128
Bso31I GGTCTC 1 cut(s) 69
Bsp143I GATC 2 cut(s) 17, 108
BspACI CCGC 1 cut(s) 88
BspCNI CTCAG 1 cut(s) 104
BspPI GGATC 2 cut(s) 12, 103
BspQI GCTCTTC 1 cut(s) 236
BspTNI GGTCTC 1 cut(s) 69
BsrBI CCGCTC 1 cut(s) 90
BsrDI GCAATG 1 cut(s) 224
BsrI ACTGG 1 cut(s) 146
BssMI GATC 2 cut(s) 17, 108
Bst6I CTCTTC 1 cut(s) 236
BstDEI CTNAG 1 cut(s) 91
BstKTI GATC 2 cut(s) 20, 111
BstMAI GTCTC 1 cut(s) 69
BstMBI GATC 2 cut(s) 17, 108
BstX2I RGATCY 1 cut(s) 17
BstYI RGATCY 1 cut(s) 17
CviJI RGCY 4 cut(s) 56, 119, 158, 178
CviKI_1 RGCY 4 cut(s) 56, 119, 158, 178
DdeI CTNAG 1 cut(s) 91
DpnI GATC 2 cut(s) 19, 110
DpnII GATC 2 cut(s) 17, 108
Eam1104I CTCTTC 1 cut(s) 236
EarI CTCTTC 1 cut(s) 236
Eco31I GGTCTC 1 cut(s) 69
Eco57I CTGAAG 1 cut(s) 213
EcoT22I ATGCAT 1 cut(s) 226
FaqI GGGAC 1 cut(s) 128
FspBI CTAG 1 cut(s) 173
HapII CCGG 2 cut(s) 21, 101
HpaII CCGG 2 cut(s) 21, 101
HphI GGTGA 3 cut(s) 35, 68, 231
Hpy166II GTNNAC 1 cut(s) 239
Hpy188I TCNGA 2 cut(s) 113, 193
Hpy188III TCNNGA 1 cut(s) 173
Hpy8I GTNNAC 1 cut(s) 239
HpyAV CCTTC 1 cut(s) 195
HpyCH4V TGCA 1 cut(s) 224
HpyF3I CTNAG 1 cut(s) 91
Kzo9I GATC 2 cut(s) 17, 108
LguI GCTCTTC 1 cut(s) 236
LmnI GCTCC 1 cut(s) 90
LpnPI CCDG 5 cut(s) 34, 62, 114, 144, 159
LweI GCATC 2 cut(s) 19, 211
MaeI CTAG 1 cut(s) 173
MaeIII GTNAC 1 cut(s) 148
MalI GATC 2 cut(s) 19, 110
MbiI CCGCTC 1 cut(s) 90
MboI GATC 2 cut(s) 17, 108
MboII GAAGA 2 cut(s) 206, 223
MflI RGATCY 1 cut(s) 17
MluCI AATT 1 cut(s) 165
MnlI CCTC 4 cut(s) 84, 130, 180, 198
Mph1103I ATGCAT 1 cut(s) 226
MspI CCGG 2 cut(s) 21, 101
NdeII GATC 2 cut(s) 17, 108
NsiI ATGCAT 1 cut(s) 226
PciSI GCTCTTC 1 cut(s) 236
PcsI WCGNNNNNNNCGW 1 cut(s) 67
PsuI RGATCY 1 cut(s) 17
SapI GCTCTTC 1 cut(s) 236
Sau3AI GATC 2 cut(s) 17, 108
SetI ASST 7 cut(s) 51, 58, 76, 81, 141, 180, 209
SfaNI GCATC 2 cut(s) 19, 211
SgeI CNNG 8 cut(s) 33, 61, 72, 113, 158, 171, 185, 230
Sse9I AATT 1 cut(s) 165
SsiI CCGC 1 cut(s) 88
SspMI CTAG 1 cut(s) 173
TaqI TCGA 1 cut(s) 70
TaqII GACCGA 1 cut(s) 51
TasI AATT 1 cut(s) 165
TspGWI ACGGA 1 cut(s) 224
XbaI TCTAGA 1 cut(s) 172
XspI CTAG 1 cut(s) 173
Zsp2I ATGCAT 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.