Rh2AG238900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0001204
Physical Location & Seq
Reverse (-)
26065388 .. 26068361
2974 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG238900.1

Sequence Viewer

Length: 204 bp
ATGCTTGAAGAGGATCTCAAACACATTGTTCTCGTCCACTACCGGGAAGAAGAGGTGCTGAATAGTTCAGAAGGGACATCAGCTTGTAAGAATGATGACCTCAGAGCAGTGTGGAACTTGCTGGATAATTCAGAATGTACATCAACTGATATGAATGAAGAACAATTGTTATACACTGTAGCGTCGTTCTCTGCCCTACTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.63

Weight (kDa)

4.2

Isoelectric Point (pI)

71.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 21
AfaI GTAC 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 43
AgsI TTSAA 1 cut(s) 8
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AlwI GGATC 1 cut(s) 21
AsuC2I CCSGG 1 cut(s) 44
BcnI CCSGG 1 cut(s) 44
BfmI CTRYAG 2 cut(s) 177, 200
Bme1390I CCNGG 1 cut(s) 44
BmrFI CCNGG 1 cut(s) 44
BpuMI CCSGG 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 43
BseMII CTCAG 1 cut(s) 115
BsiSI CCGG 1 cut(s) 43
BslFI GGGAC 1 cut(s) 88
BslI CCNNNNNNNGG 1 cut(s) 43
BsmFI GGGAC 1 cut(s) 88
Bsp1407I TGTACA 1 cut(s) 137
Bsp143I GATC 1 cut(s) 13
BspCNI CTCAG 1 cut(s) 114
BspPI GGATC 1 cut(s) 21
BsrGI TGTACA 1 cut(s) 137
BssMI GATC 1 cut(s) 13
Bst4CI ACNGT 2 cut(s) 178, 201
Bst6I CTCTTC 2 cut(s) 3, 45
BstAUI TGTACA 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 101
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstSCI CCNGG 1 cut(s) 42
BstSFI CTRYAG 2 cut(s) 177, 200
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BtsI GCAGTG 1 cut(s) 114
BtsIMutI CAGTG 2 cut(s) 114, 174
CseI GACGC 1 cut(s) 171
Csp6I GTAC 1 cut(s) 138
CviJI RGCY 1 cut(s) 83
CviKI_1 RGCY 1 cut(s) 83
CviQI GTAC 1 cut(s) 138
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
Eam1104I CTCTTC 2 cut(s) 3, 45
EarI CTCTTC 2 cut(s) 3, 45
FaiI YATR 2 cut(s) 152, 172
FaqI GGGAC 1 cut(s) 88
HapII CCGG 1 cut(s) 43
HgaI GACGC 1 cut(s) 171
HpaII CCGG 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 3 cut(s) 70, 104, 133
Hpy8I GTNNAC 1 cut(s) 37
Hpy99I CGWCG 1 cut(s) 187
HpyAV CCTTC 1 cut(s) 65
HpyCH4III ACNGT 2 cut(s) 178, 201
HpyF3I CTNAG 1 cut(s) 101
Kzo9I GATC 1 cut(s) 13
LpnPI CCDG 2 cut(s) 56, 107
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 4 cut(s) 20, 59, 62, 170
MfeI CAATTG 1 cut(s) 164
MflI RGATCY 1 cut(s) 13
MluCI AATT 2 cut(s) 127, 164
MnlI CCTC 3 cut(s) 4, 46, 110
MspI CCGG 1 cut(s) 43
MspR9I CCNGG 1 cut(s) 44
MunI CAATTG 1 cut(s) 164
NciI CCSGG 1 cut(s) 44
NdeII GATC 1 cut(s) 13
PsuI RGATCY 1 cut(s) 13
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
Sau3AI GATC 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 44
SetI ASST 3 cut(s) 57, 85, 102
SfcI CTRYAG 2 cut(s) 177, 200
SgeI CNNG 7 cut(s) 17, 44, 55, 56, 96, 130, 134
Sse9I AATT 2 cut(s) 127, 164
StyD4I CCNGG 1 cut(s) 42
TaaI ACNGT 2 cut(s) 178, 201
TasI AATT 2 cut(s) 127, 164
TatI WGTACW 1 cut(s) 137
TscAI CASTG 2 cut(s) 114, 181
TspDTI ATGAA 2 cut(s) 167, 171
TspRI CASTG 2 cut(s) 114, 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.