Rh2CG242800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001204
Physical Location & Seq
Reverse (-)
25457023 .. 25460827
3805 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG242800.1

Sequence Viewer

Length: 267 bp
ATGACTTTGAGATCCTCCCCCTATAAGAACAAGAAGGAGTTTCACGAGAGAAATCCCAGTCTACGTCCTCATCGAATACAAACCCTAACAAGAACCCAGCTTCCGGCGACGACTACGGCTATGGACGAAACTATTAGATCCGGTGACGATGCTCGAGCTCTAACTAACCAGATAGCTTCTCGGTCTCACCGACCTCACCTACTGCTAGTCGCTCGATCTCCAAATCTTCGCCATTCTCGACCCCAAGCTCAATCTAGCTCTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.04

Weight (kDa)

11.71

Isoelectric Point (pI)

79.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 61
AclWI GGATC 2 cut(s) 6, 132
AfiI CCNNNNNNNGG 1 cut(s) 103
AloI GAACNNNNNNTCC 2 cut(s) 85, 117
AluBI AGCT 5 cut(s) 100, 158, 176, 248, 258
AluI AGCT 5 cut(s) 100, 158, 176, 248, 258
Alw21I GWGCWC 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 189
AlwI GGATC 2 cut(s) 6, 132
Ama87I CYCGRG 1 cut(s) 153
AsuHPI GGTGA 3 cut(s) 155, 179, 188
AvaI CYCGRG 1 cut(s) 153
BanII GRGCYC 1 cut(s) 160
BauI CACGAG 1 cut(s) 44
Bbv12I GWGCWC 1 cut(s) 160
BceAI ACGGC 1 cut(s) 132
BcoDI GTCTC 1 cut(s) 189
BfaI CTAG 2 cut(s) 206, 255
BmeT110I CYCGRG 1 cut(s) 153
BmrI ACTGGG 1 cut(s) 51
BmsI GCATC 1 cut(s) 139
BmuI ACTGGG 1 cut(s) 51
BsaI GGTCTC 1 cut(s) 189
BsaWI WCCGGW 1 cut(s) 140
Bsc4I CCNNNNNNNGG 1 cut(s) 103
Bse1I ACTGG 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 103
BseNI ACTGG 1 cut(s) 57
BseYI CCCAGC 1 cut(s) 96
BsiHKAI GWGCWC 1 cut(s) 160
BsiHKCI CYCGRG 1 cut(s) 153
BsiSI CCGG 2 cut(s) 104, 141
BslI CCNNNNNNNGG 1 cut(s) 103
BsmAI GTCTC 1 cut(s) 189
Bso31I GGTCTC 1 cut(s) 189
BsoBI CYCGRG 1 cut(s) 153
Bsp1286I GDGCHC 1 cut(s) 160
Bsp143I GATC 3 cut(s) 11, 137, 215
BspPI GGATC 2 cut(s) 6, 132
BspTNI GGTCTC 1 cut(s) 189
BsrI ACTGG 1 cut(s) 57
BssMI GATC 3 cut(s) 11, 137, 215
BssSI CACGAG 1 cut(s) 44
Bst2BI CACGAG 1 cut(s) 44
BstKTI GATC 3 cut(s) 14, 140, 218
BstMAI GTCTC 1 cut(s) 189
BstMBI GATC 3 cut(s) 11, 137, 215
BstX2I RGATCY 2 cut(s) 11, 137
BstYI RGATCY 2 cut(s) 11, 137
CviJI RGCY 6 cut(s) 100, 119, 158, 176, 248, 258
CviKI_1 RGCY 6 cut(s) 100, 119, 158, 176, 248, 258
DpnI GATC 3 cut(s) 13, 139, 217
DpnII GATC 3 cut(s) 11, 137, 215
Ecl136II GAGCTC 1 cut(s) 158
Eco24I GRGCYC 1 cut(s) 160
Eco31I GGTCTC 1 cut(s) 189
Eco53kI GAGCTC 1 cut(s) 158
Eco88I CYCGRG 1 cut(s) 153
EcoICRI GAGCTC 1 cut(s) 158
EcoT38I GRGCYC 1 cut(s) 160
FaiI YATR 2 cut(s) 24, 122
FblI GTMKAC 1 cut(s) 61
FriOI GRGCYC 1 cut(s) 160
FspBI CTAG 2 cut(s) 206, 255
GsaI CCCAGC 1 cut(s) 100
HapII CCGG 2 cut(s) 104, 141
HpaII CCGG 2 cut(s) 104, 141
HphI GGTGA 3 cut(s) 155, 179, 188
Hpy166II GTNNAC 1 cut(s) 62
Hpy188III TCNNGA 2 cut(s) 44, 237
Hpy8I GTNNAC 1 cut(s) 62
Hpy99I CGWCG 1 cut(s) 112
HpyAV CCTTC 1 cut(s) 28
HpyCH4IV ACGT 1 cut(s) 64
HpySE526I ACGT 1 cut(s) 64
Kzo9I GATC 3 cut(s) 11, 137, 215
LpnPI CCDG 5 cut(s) 70, 110, 117, 154, 182
LweI GCATC 1 cut(s) 139
MaeI CTAG 2 cut(s) 206, 255
MaeII ACGT 1 cut(s) 64
MaeIII GTNAC 1 cut(s) 143
MalI GATC 3 cut(s) 13, 139, 217
MboI GATC 3 cut(s) 11, 137, 215
MboII GAAGA 1 cut(s) 218
MflI RGATCY 2 cut(s) 11, 137
MhlI GDGCHC 1 cut(s) 160
MluCI AATT 1 cut(s) 262
MnlI CCTC 3 cut(s) 25, 78, 204
MspI CCGG 2 cut(s) 104, 141
NdeII GATC 3 cut(s) 11, 137, 215
NmuCI GTSAC 1 cut(s) 143
PaeR7I CTCGAG 1 cut(s) 153
PcsI WCGNNNNNNNCGW 3 cut(s) 70, 187, 235
Psp124BI GAGCTC 1 cut(s) 160
PspFI CCCAGC 1 cut(s) 96
PspXI VCTCGAGB 1 cut(s) 153
PsuI RGATCY 2 cut(s) 11, 137
SacI GAGCTC 1 cut(s) 160
Sau3AI GATC 3 cut(s) 11, 137, 215
SduI GDGCHC 1 cut(s) 160
SetI ASST 8 cut(s) 67, 102, 160, 178, 196, 201, 250, 260
SfaNI GCATC 1 cut(s) 139
Sfr274I CTCGAG 1 cut(s) 153
SlaI CTCGAG 1 cut(s) 153
SmlI CTYRAG 1 cut(s) 153
SmoI CTYRAG 1 cut(s) 153
Sse9I AATT 1 cut(s) 262
SspMI CTAG 2 cut(s) 206, 255
SstI GAGCTC 1 cut(s) 160
TaiI ACGT 1 cut(s) 67
TaqI TCGA 4 cut(s) 73, 154, 214, 238
TaqII GACCGA 1 cut(s) 171
TasI AATT 1 cut(s) 262
TseFI GTSAC 1 cut(s) 143
Tsp45I GTSAC 1 cut(s) 143
XhoI CTCGAG 1 cut(s) 153
XmiI GTMKAC 1 cut(s) 61
XspI CTAG 2 cut(s) 206, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.