Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000004

Orthogroup ID

OG0002036

Physical Location & Seq

Genomic Coordinates Forward (+)

62004512 .. 62005695

Gene Structure 1184 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_4G00328890.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 576 bp

ATGATTTCGATAGCGATGCCTTCTCCTACCATACATGTTCCGCCGAAACCCAAGCGGACCTTGAAGAAGATGGCGGAGGAGTACGAGGTGAAAGATGAATCTTCCCTTGTTGAAGTTGCCAAGATTTCAGGCAAGATGAACTTCTATGATCACATTACGTTGGGTGATTGCTCACCTTCAATGGCTAAACAGAAGATTTTGGGGGAGGTGATCAAGCTGGGTCACATGATCTTTATGAGCAAAGAGCTTGAGAAGAAATTTCTCTACTATCCAAATGTCATTGATCAAAAGGCCTTGGCAAACCTGCAAAATGCCGAGAAGAGGAGAAAATTTGAGGAGGTTAGGGCAACTGTGAAGGAAGGCGCTAGTGGTCAAGTATCTCGAACTGAGATTGATGATCAGGAAGCAAGTATGTCAAAGAATGAAGAGGACTCTGGAATTGGGACGCAAACATCAAATACTACTACTTCTACTTCTATGTCTAGGATTATGACAACTTTTAGTGCTCGGCTTGCGGTTACCCTTGGCATAACTTTGCAGACTGATGGGTCCCAATACTTAGGCATTGAGAATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

191

Amino Acids

21.22

Weight (kDa)

6.85

Isoelectric Point (pI)

60.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002036)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g28880 FvH4_1g29111 FvH4_1g29422 FvH4_3g26312 FvH4_3g30613 FvH4_3g37082 FvH4_6g20922
rosa_chinensis	RchiOBHm_Chr6g0267751
rosa_laevigata	RLG00000001633 RLG00000009125 RLG00000009185 RLG00000013920 RLG00000029463 RLG00000035008
rosa_multiflora	Rmu_sc0000725.1_g000014 Rmu_sc0007681.1_g000006 Rmu_sc0008058.1_g000006 Rmu_ssc0000146.1_g000011
rosa_roxburghii	Rroxscaffold_3G00236910 Rroxscaffold_4G00328890 Rroxscaffold_5G00347550 Rroxscaffold_7G00199890
rosa_rugosa	Rorug03G0294400 Rorug04G0032500 Rorug07G0164400 Rorug07G0242300
rosa_samantha	Rh1AG092000 Rh1AG092100 Rh1CG089000 Rh1CG089100 Rh4AG132600 Rh4BG108900 Rh4CG140300 Rh4DG100900 Rh4DG101000 Rh4DG109200 Rh6BG164600 Rh6DG150300 Rh6DG150400 Rh7AG351300 Rh7BG377400 Rh7BG408800 Rh7CG332900 Rh7CG368600 Rh7DG348100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	547
Acc36I	ACCTGC	1 cut(s)	312
AciI	CCGC	4 cut(s)	41, 55, 74, 515
AcsI	RAATTY	2 cut(s)	257, 329
AfaI	GTAC	1 cut(s)	83
AfiI	CCNNNNNNNGG	1 cut(s)	321
AflIII	ACRYGT	1 cut(s)	34
AgsI	TTSAA	3 cut(s)	64, 113, 180
AluBI	AGCT	2 cut(s)	217, 247
AluI	AGCT	2 cut(s)	217, 247
Alw21I	GWGCWC	1 cut(s)	508
AoxI	GGCC	1 cut(s)	291
ApoI	RAATTY	2 cut(s)	257, 329
AspLEI	GCGC	1 cut(s)	365
AspS9I	GGNCC	2 cut(s)	57, 549
AsuHPI	GGTGA	4 cut(s)	100, 165, 176, 220
AvaII	GGWCC	2 cut(s)	57, 549
Bbv12I	GWGCWC	1 cut(s)	508
BccI	CCATC	2 cut(s)	64, 539
BcgI	CGANNNNNNTGC	1 cut(s)	32
BclI	TGATCA	4 cut(s)	148, 210, 283, 397
BfaI	CTAG	2 cut(s)	366, 483
BfoI	RGCGCY	1 cut(s)	366
BfuAI	ACCTGC	1 cut(s)	312
Bme18I	GGWCC	2 cut(s)	57, 549
BmgT120I	GGNCC	2 cut(s)	57, 549
BmiI	GGNNCC	2 cut(s)	550, 551
BmsI	GCATC	1 cut(s)	6
BpuEI	CTTGAG	1 cut(s)	269
BsaJI	CCNNGG	2 cut(s)	294, 523
Bsc4I	CCNNNNNNNGG	1 cut(s)	321
BseDI	CCNNGG	2 cut(s)	294, 523
BseLI	CCNNNNNNNGG	1 cut(s)	321
BseMII	CTCAG	1 cut(s)	378
BseRI	GAGGAG	3 cut(s)	92, 337, 350
BseYI	CCCAGC	1 cut(s)	217
BshFI	GGCC	1 cut(s)	293
BsiHKAI	GWGCWC	1 cut(s)	508
BslFI	GGGAC	2 cut(s)	457, 535
BslI	CCNNNNNNNGG	1 cut(s)	321
BsmFI	GGGAC	2 cut(s)	457, 535
BsnI	GGCC	1 cut(s)	293
Bsp1286I	GDGCHC	1 cut(s)	508
Bsp143I	GATC	5 cut(s)	148, 210, 228, 283, 397
BspACI	CCGC	4 cut(s)	41, 55, 74, 515
BspANI	GGCC	1 cut(s)	293
BspCNI	CTCAG	1 cut(s)	379
BspLI	GGNNCC	2 cut(s)	550, 551
BspMI	ACCTGC	1 cut(s)	312
BssECI	CCNNGG	2 cut(s)	294, 523
BssMI	GATC	5 cut(s)	148, 210, 228, 283, 397
BssT1I	CCWWGG	2 cut(s)	294, 523
Bst4CI	ACNGT	1 cut(s)	352
Bst6I	CTCTTC	2 cut(s)	314, 420
BstC8I	GCNNGC	1 cut(s)	513
BstDEI	CTNAG	2 cut(s)	387, 559
BstEII	GGTNACC	1 cut(s)	517
BstH2I	RGCGCY	1 cut(s)	366
BstHHI	GCGC	1 cut(s)	365
BstKTI	GATC	5 cut(s)	151, 213, 231, 286, 400
BstMBI	GATC	5 cut(s)	148, 210, 228, 283, 397
BstMWI	GCNNNNNNNGC	1 cut(s)	512
BstNSI	RCATGY	1 cut(s)	38
BstPI	GGTNACC	1 cut(s)	517
BsuRI	GGCC	1 cut(s)	293
BtgZI	GCGATG	1 cut(s)	29
BveI	ACCTGC	1 cut(s)	312
Cac8I	GCNNGC	1 cut(s)	513
CfoI	GCGC	1 cut(s)	365
Cfr13I	GGNCC	2 cut(s)	57, 549
CseI	GACGC	1 cut(s)	454
Csp6I	GTAC	1 cut(s)	82
CviAII	CATG	2 cut(s)	35, 226
CviJI	RGCY	5 cut(s)	185, 217, 247, 293, 511
CviKI_1	RGCY	5 cut(s)	185, 217, 247, 293, 511
CviQI	GTAC	1 cut(s)	82
DdeI	CTNAG	2 cut(s)	387, 559
DpnI	GATC	5 cut(s)	150, 212, 230, 285, 399
DpnII	GATC	5 cut(s)	148, 210, 228, 283, 397
DrdI	GACNNNNNNGTC	1 cut(s)	547
DseDI	GACNNNNNNGTC	1 cut(s)	547
Eam1104I	CTCTTC	2 cut(s)	314, 420
EarI	CTCTTC	2 cut(s)	314, 420
EciI	GGCGGA	2 cut(s)	30, 89
Eco130I	CCWWGG	2 cut(s)	294, 523
Eco147I	AGGCCT	1 cut(s)	293
Eco47I	GGWCC	2 cut(s)	57, 549
Eco91I	GGTNACC	1 cut(s)	517
EcoO109I	RGGNCCY	1 cut(s)	549
EcoO65I	GGTNACC	1 cut(s)	517
EcoT14I	CCWWGG	2 cut(s)	294, 523
ErhI	CCWWGG	2 cut(s)	294, 523
FaeI	CATG	2 cut(s)	38, 229
FaiI	YATR	9 cut(s)	32, 36, 147, 227, 236, 413, 479, 491, 530
FalI	AAGNNNNNCTT	4 cut(s)	44, 76, 125, 157
FaqI	GGGAC	2 cut(s)	457, 535
FatI	CATG	2 cut(s)	34, 225
FbaI	TGATCA	4 cut(s)	148, 210, 283, 397
FspBI	CTAG	2 cut(s)	366, 483
GlaI	GCGC	1 cut(s)	364
GsaI	CCCAGC	1 cut(s)	221
HaeII	RGCGCY	1 cut(s)	366
HaeIII	GGCC	1 cut(s)	293
HgaI	GACGC	1 cut(s)	454
HhaI	GCGC	1 cut(s)	365
Hin1II	CATG	2 cut(s)	38, 229
Hin6I	GCGC	1 cut(s)	363
HinP1I	GCGC	1 cut(s)	363
HinfI	GANTC	2 cut(s)	98, 431
HphI	GGTGA	4 cut(s)	100, 165, 176, 220
Hpy188III	TCNNGA	3 cut(s)	381, 401, 435
HpyAV	CCTTC	4 cut(s)	30, 186, 349, 353
HpyCH4III	ACNGT	1 cut(s)	352
HpyCH4IV	ACGT	1 cut(s)	158
HpyCH4V	TGCA	2 cut(s)	307, 538
HpyF10VI	GCNNNNNNNGC	1 cut(s)	512
HpyF3I	CTNAG	2 cut(s)	387, 559
HpySE526I	ACGT	1 cut(s)	158
Hsp92II	CATG	2 cut(s)	38, 229
HspAI	GCGC	1 cut(s)	363
KflI	GGGWCCC	1 cut(s)	549
Ksp22I	TGATCA	4 cut(s)	148, 210, 283, 397
Kzo9I	GATC	5 cut(s)	148, 210, 228, 283, 397
LpnPI	CCDG	5 cut(s)	114, 203, 317, 386, 420
LweI	GCATC	1 cut(s)	6
MaeI	CTAG	2 cut(s)	366, 483
MaeII	ACGT	1 cut(s)	158
MaeIII	GTNAC	2 cut(s)	221, 517
MalI	GATC	5 cut(s)	150, 212, 230, 285, 399
MboI	GATC	5 cut(s)	148, 210, 228, 283, 397
MboII	GAAGA	7 cut(s)	76, 79, 93, 205, 265, 331, 437
MhlI	GDGCHC	1 cut(s)	508
MluCI	AATT	4 cut(s)	257, 329, 438, 571
MlyI	GAGTC	1 cut(s)	425
MnlI	CCTC	7 cut(s)	70, 79, 199, 315, 328, 331, 421
MseI	TTAA	1 cut(s)	574
MwoI	GCNNNNNNNGC	1 cut(s)	512
NdeII	GATC	5 cut(s)	148, 210, 228, 283, 397
NlaIII	CATG	2 cut(s)	38, 229
NlaIV	GGNNCC	2 cut(s)	550, 551
NmeAIII	GCCGAG	2 cut(s)	340, 487
NmuCI	GTSAC	1 cut(s)	221
NspI	RCATGY	1 cut(s)	38
PceI	AGGCCT	1 cut(s)	293
PciI	ACATGT	1 cut(s)	34
PfeI	GAWTC	1 cut(s)	98
PleI	GAGTC	1 cut(s)	425
PpsI	GAGTC	1 cut(s)	425
PpuMI	RGGWCCY	1 cut(s)	549
PscI	ACATGT	1 cut(s)	34
Psp5II	RGGWCCY	1 cut(s)	549
PspEI	GGTNACC	1 cut(s)	517
PspFI	CCCAGC	1 cut(s)	217
PspN4I	GGNNCC	2 cut(s)	550, 551
PspPI	GGNCC	2 cut(s)	57, 549
PspPPI	RGGWCCY	1 cut(s)	549
RsaI	GTAC	1 cut(s)	83
RsaNI	GTAC	1 cut(s)	82
SaqAI	TTAA	1 cut(s)	574
Sau3AI	GATC	5 cut(s)	148, 210, 228, 283, 397
Sau96I	GGNCC	2 cut(s)	57, 549
SchI	GAGTC	1 cut(s)	425
SduI	GDGCHC	1 cut(s)	508
SetI	ASST	9 cut(s)	62, 90, 161, 178, 210, 219, 249, 306, 342
SfaNI	GCATC	1 cut(s)	6
SinI	GGWCC	2 cut(s)	57, 549
SmlI	CTYRAG	1 cut(s)	248
SmoI	CTYRAG	1 cut(s)	248
Sse9I	AATT	4 cut(s)	257, 329, 438, 571
SseBI	AGGCCT	1 cut(s)	293
SsiI	CCGC	4 cut(s)	41, 55, 74, 515
SspMI	CTAG	2 cut(s)	366, 483
StuI	AGGCCT	1 cut(s)	293
StyI	CCWWGG	2 cut(s)	294, 523
TaaI	ACNGT	1 cut(s)	352
TaiI	ACGT	1 cut(s)	161
TaqI	TCGA	2 cut(s)	8, 382
TasI	AATT	4 cut(s)	257, 329, 438, 571
TfiI	GAWTC	1 cut(s)	98
Tru1I	TTAA	1 cut(s)	574
Tru9I	TTAA	1 cut(s)	574
TseFI	GTSAC	1 cut(s)	221
Tsp45I	GTSAC	1 cut(s)	221
TspDTI	ATGAA	3 cut(s)	111, 152, 438
VpaK11BI	GGWCC	2 cut(s)	57, 549
XapI	RAATTY	2 cut(s)	257, 329
XceI	RCATGY	1 cut(s)	38
XspI	CTAG	2 cut(s)	366, 483

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.