Rh7AG351300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
44801776 .. 44802588
813 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG351300.1

Sequence Viewer

Length: 258 bp
ATGGCTCCGGCAAATGACCAAATTTTTTGGTCCCGTTATTGGGGTGAATGTGACGAGGCGAGGCTCAAGATTGCTGGCTTGAACAAAGAAGTCACAACCTTGAAGAAGAAACTGGAGAAACAAACCAAGGATAACAAGGCTTTGGAAGCCCATGATCGGAAGCGGGAGATAGAGCAGTTGACCAAGGAGCTGGAGGATAGGGATGTGAACCTTAACTTGGCTAAGCCAAGCTTGCCAGATGTGGATGAGGAGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.91

Weight (kDa)

5.21

Isoelectric Point (pI)

42.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 163
AcsI RAATTY 1 cut(s) 21
AfiI CCNNNNNNNGG 4 cut(s) 39, 40, 156, 217
AgsI TTSAA 2 cut(s) 82, 103
AjuI GAANNNNNNNTTGG 2 cut(s) 200, 232
AluBI AGCT 2 cut(s) 190, 231
AluI AGCT 2 cut(s) 190, 231
ApoI RAATTY 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 56
AvaII GGWCC 1 cut(s) 30
BlpI GCTNAGC 1 cut(s) 222
Bme18I GGWCC 1 cut(s) 30
BmgT120I GGNCC 1 cut(s) 30
BmiI GGNNCC 2 cut(s) 6, 32
BpmI CTGGAG 2 cut(s) 134, 212
Bpu1102I GCTNAGC 1 cut(s) 222
BpuEI CTTGAG 1 cut(s) 50
BsaJI CCNNGG 2 cut(s) 126, 183
Bsc4I CCNNNNNNNGG 4 cut(s) 39, 40, 156, 217
Bse1I ACTGG 1 cut(s) 117
BseDI CCNNGG 2 cut(s) 126, 183
BseGI GGATG 2 cut(s) 208, 250
BseLI CCNNNNNNNGG 4 cut(s) 39, 40, 156, 217
BseNI ACTGG 1 cut(s) 117
BsiSI CCGG 1 cut(s) 8
BslFI GGGAC 1 cut(s) 16
BslI CCNNNNNNNGG 4 cut(s) 39, 40, 156, 217
BsmFI GGGAC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 154
Bsp1720I GCTNAGC 1 cut(s) 222
BspACI CCGC 1 cut(s) 163
BspLI GGNNCC 2 cut(s) 6, 32
BsrI ACTGG 1 cut(s) 117
BssECI CCNNGG 2 cut(s) 126, 183
BssMI GATC 1 cut(s) 154
BssT1I CCWWGG 2 cut(s) 126, 183
BstC8I GCNNGC 2 cut(s) 76, 233
BstDEI CTNAG 1 cut(s) 222
BstF5I GGATG 2 cut(s) 208, 250
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMWI GCNNNNNNNGC 2 cut(s) 146, 232
BstXI CCANNNNNNTGG 1 cut(s) 190
BtsCI GGATG 2 cut(s) 208, 250
Cac8I GCNNGC 2 cut(s) 76, 233
Cfr13I GGNCC 1 cut(s) 30
CviAII CATG 1 cut(s) 152
CviJI RGCY 9 cut(s) 5, 64, 78, 140, 149, 190, 221, 226, 231
CviKI_1 RGCY 9 cut(s) 5, 64, 78, 140, 149, 190, 221, 226, 231
DdeI CTNAG 1 cut(s) 222
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Eco130I CCWWGG 2 cut(s) 126, 183
Eco47I GGWCC 1 cut(s) 30
EcoT14I CCWWGG 2 cut(s) 126, 183
ErhI CCWWGG 2 cut(s) 126, 183
FaeI CATG 1 cut(s) 155
FaiI YATR 1 cut(s) 153
FalI AAGNNNNNCTT 2 cut(s) 215, 247
FaqI GGGAC 1 cut(s) 16
FatI CATG 1 cut(s) 151
FauI CCCGC 1 cut(s) 156
FokI GGATG 1 cut(s) 215
GsuI CTGGAG 2 cut(s) 134, 212
HapII CCGG 1 cut(s) 8
Hin1II CATG 1 cut(s) 155
HincII GTYRAC 1 cut(s) 180
HindII GTYRAC 1 cut(s) 180
HindIII AAGCTT 1 cut(s) 229
HpaII CCGG 1 cut(s) 8
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 2 cut(s) 180, 208
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 1 cut(s) 67
Hpy8I GTNNAC 2 cut(s) 180, 208
HpyF10VI GCNNNNNNNGC 2 cut(s) 146, 232
HpyF3I CTNAG 1 cut(s) 222
Hsp92II CATG 1 cut(s) 155
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 2 cut(s) 10, 187
LpnPI CCDG 5 cut(s) 21, 60, 98, 176, 249
MaeIII GTNAC 2 cut(s) 50, 91
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 2 cut(s) 115, 118
MluCI AATT 1 cut(s) 21
MnlI CCTC 5 cut(s) 49, 54, 187, 241, 244
MseI TTAA 1 cut(s) 213
MspI CCGG 1 cut(s) 8
MwoI GCNNNNNNNGC 2 cut(s) 146, 232
NdeII GATC 1 cut(s) 154
NlaIII CATG 1 cut(s) 155
NlaIV GGNNCC 2 cut(s) 6, 32
NmuCI GTSAC 2 cut(s) 50, 91
PspN4I GGNNCC 2 cut(s) 6, 32
PspPI GGNCC 1 cut(s) 30
SaqAI TTAA 1 cut(s) 213
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 30
SetI ASST 5 cut(s) 101, 192, 213, 233, 255
SinI GGWCC 1 cut(s) 30
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
Sse9I AATT 1 cut(s) 21
SsiI CCGC 1 cut(s) 163
StyI CCWWGG 2 cut(s) 126, 183
TasI AATT 1 cut(s) 21
Tru1I TTAA 1 cut(s) 213
Tru9I TTAA 1 cut(s) 213
TseFI GTSAC 2 cut(s) 50, 91
Tsp45I GTSAC 2 cut(s) 50, 91
VpaK11BI GGWCC 1 cut(s) 30
XapI RAATTY 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.