Rh4CG140300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
27847590 .. 27849357
1768 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG140300.1

Sequence Viewer

Length: 339 bp
ATGGATTCTCATATTCTTGAAGCGATTCCCATGAGCTGGGTTATGGTGGATGGACAAGCTATGACATTTCTAGCAAGGTGGATGGGCAAGCGTCAAGAGCCCATGCAATTGATGATTGAGGAGGAGATAGAGGTGATGCGAGCGAACTATGACATTTATAGCAAGGTGAAACTACAACCATTGAGGGATGGTAAGTTGGTGATACAATTGCCTGTGAGTCATATGGTGGTCAATGAGATCTTGATTAAGCTTGGTCTGAATTTAGCTATGCATCCATGGGTGCAATATGTTTTGTCTAGTTTGAAGATCCTCATCTCACAAGTAACTTTGTACATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.03

Weight (kDa)

6.26

Isoelectric Point (pI)

66.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 36
AclWI GGATC 1 cut(s) 301
AcsI RAATTY 1 cut(s) 259
AfaI GTAC 1 cut(s) 332
AfiI CCNNNNNNNGG 1 cut(s) 36
AflIII ACRYGT 1 cut(s) 333
AgsI TTSAA 2 cut(s) 20, 304
AluBI AGCT 4 cut(s) 36, 59, 250, 266
AluI AGCT 4 cut(s) 36, 59, 250, 266
AlwI GGATC 1 cut(s) 301
ApoI RAATTY 1 cut(s) 259
Asp700I GAANNNNTTC 1 cut(s) 24
AsuHPI GGTGA 3 cut(s) 145, 178, 211
BanII GRGCYC 1 cut(s) 102
BccI CCATC 3 cut(s) 44, 76, 182
BfaI CTAG 2 cut(s) 71, 297
BglII AGATCT 1 cut(s) 237
BmsI GCATC 2 cut(s) 126, 280
BsaBI GATNNNNATC 1 cut(s) 311
BsaJI CCNNGG 1 cut(s) 275
Bsc4I CCNNNNNNNGG 1 cut(s) 36
Bse8I GATNNNNATC 1 cut(s) 311
BseDI CCNNGG 1 cut(s) 275
BseGI GGATG 4 cut(s) 55, 87, 193, 271
BseJI GATNNNNATC 1 cut(s) 311
BseLI CCNNNNNNNGG 1 cut(s) 36
BseRI GAGGAG 2 cut(s) 134, 137
BseYI CCCAGC 1 cut(s) 36
BslI CCNNNNNNNGG 1 cut(s) 36
Bsp1286I GDGCHC 1 cut(s) 102
Bsp1407I TGTACA 1 cut(s) 330
Bsp143I GATC 2 cut(s) 237, 306
Bsp19I CCATGG 1 cut(s) 275
BspPI GGATC 1 cut(s) 301
BsrGI TGTACA 1 cut(s) 330
BssECI CCNNGG 1 cut(s) 275
BssMI GATC 2 cut(s) 237, 306
BssT1I CCWWGG 1 cut(s) 275
BstAUI TGTACA 1 cut(s) 330
BstC8I GCNNGC 2 cut(s) 89, 141
BstDSI CCRYGG 1 cut(s) 275
BstF5I GGATG 4 cut(s) 55, 87, 193, 271
BstKTI GATC 2 cut(s) 240, 309
BstMBI GATC 2 cut(s) 237, 306
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstNSI RCATGY 1 cut(s) 337
BstX2I RGATCY 2 cut(s) 237, 306
BstYI RGATCY 2 cut(s) 237, 306
BtgI CCRYGG 1 cut(s) 275
BtsCI GGATG 4 cut(s) 55, 87, 193, 271
Cac8I GCNNGC 2 cut(s) 89, 141
CseI GACGC 1 cut(s) 80
Csp6I GTAC 1 cut(s) 331
CviAII CATG 4 cut(s) 31, 103, 276, 334
CviJI RGCY 5 cut(s) 36, 59, 100, 250, 266
CviKI_1 RGCY 5 cut(s) 36, 59, 100, 250, 266
CviQI GTAC 1 cut(s) 331
DpnI GATC 2 cut(s) 239, 308
DpnII GATC 2 cut(s) 237, 306
Eco130I CCWWGG 1 cut(s) 275
Eco24I GRGCYC 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 275
EcoT22I ATGCAT 1 cut(s) 273
EcoT38I GRGCYC 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 275
FaeI CATG 4 cut(s) 34, 106, 279, 337
FatI CATG 4 cut(s) 30, 102, 275, 333
FauNDI CATATG 1 cut(s) 222
FokI GGATG 4 cut(s) 62, 94, 200, 258
FriOI GRGCYC 1 cut(s) 102
FspBI CTAG 2 cut(s) 71, 297
GsaI CCCAGC 1 cut(s) 40
HgaI GACGC 1 cut(s) 80
Hin1II CATG 4 cut(s) 34, 106, 279, 337
HindIII AAGCTT 1 cut(s) 248
HinfI GANTC 3 cut(s) 5, 25, 217
HphI GGTGA 3 cut(s) 145, 178, 211
Hpy188I TCNGA 1 cut(s) 258
Hpy188III TCNNGA 3 cut(s) 17, 95, 241
HpyCH4V TGCA 3 cut(s) 106, 271, 283
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
Hsp92II CATG 4 cut(s) 34, 106, 279, 337
Kzo9I GATC 2 cut(s) 237, 306
LpnPI CCDG 2 cut(s) 22, 225
LweI GCATC 2 cut(s) 126, 280
MaeI CTAG 2 cut(s) 71, 297
MaeIII GTNAC 1 cut(s) 322
MalI GATC 2 cut(s) 239, 308
MboI GATC 2 cut(s) 237, 306
MboII GAAGA 1 cut(s) 316
MfeI CAATTG 2 cut(s) 107, 206
MflI RGATCY 2 cut(s) 237, 306
MhlI GDGCHC 1 cut(s) 102
MluCI AATT 3 cut(s) 107, 206, 259
MlyI GAGTC 1 cut(s) 226
MnlI CCTC 5 cut(s) 112, 115, 124, 177, 320
Mph1103I ATGCAT 1 cut(s) 273
MroXI GAANNNNTTC 1 cut(s) 24
MseI TTAA 1 cut(s) 246
MunI CAATTG 2 cut(s) 107, 206
MwoI GCNNNNNNNGC 1 cut(s) 97
NcoI CCATGG 1 cut(s) 275
NdeI CATATG 1 cut(s) 222
NdeII GATC 2 cut(s) 237, 306
NlaIII CATG 4 cut(s) 34, 106, 279, 337
NsiI ATGCAT 1 cut(s) 273
NspI RCATGY 1 cut(s) 337
PciI ACATGT 1 cut(s) 333
PdmI GAANNNNTTC 1 cut(s) 24
PfeI GAWTC 2 cut(s) 5, 25
PflMI CCANNNNNTGG 1 cut(s) 36
PleI GAGTC 1 cut(s) 225
PpsI GAGTC 1 cut(s) 225
PscI ACATGT 1 cut(s) 333
PspFI CCCAGC 1 cut(s) 36
PsuI RGATCY 2 cut(s) 237, 306
RsaI GTAC 1 cut(s) 332
RsaNI GTAC 1 cut(s) 331
SaqAI TTAA 1 cut(s) 246
Sau3AI GATC 2 cut(s) 237, 306
SchI GAGTC 1 cut(s) 226
SduI GDGCHC 1 cut(s) 102
SetI ASST 7 cut(s) 38, 61, 80, 135, 168, 252, 268
SfaNI GCATC 2 cut(s) 126, 280
Sse9I AATT 3 cut(s) 107, 206, 259
SspMI CTAG 2 cut(s) 71, 297
StyI CCWWGG 1 cut(s) 275
TasI AATT 3 cut(s) 107, 206, 259
TatI WGTACW 1 cut(s) 330
TfiI GAWTC 2 cut(s) 5, 25
Tru1I TTAA 1 cut(s) 246
Tru9I TTAA 1 cut(s) 246
Van91I CCANNNNNTGG 1 cut(s) 36
XapI RAATTY 1 cut(s) 259
XceI RCATGY 1 cut(s) 337
XmnI GAANNNNTTC 1 cut(s) 24
XspI CTAG 2 cut(s) 71, 297
Zsp2I ATGCAT 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.