Rh2CG514400

Belongs to the argonaute family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
68847190 .. 68848734
1545 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG514400.1

Sequence Viewer

Length: 315 bp
ATGCTTAATGATCATGTTTCTGCTACAATCTCCTGGAGCTATCAGGCTTACAAGCACCACCAGAAGGTTGATGAGATTCCAAAATTTAATGTGCTTGTGGCTCAAAAGAACCATAATACAAAGCTATTCCAAGCTGTTTTTCCCCAGCATAATGTTCCACCAGGAACAGTTGTGGACACAAATATTGTGCATCCAAGGAATTATGATTTCTACATGTGTGCTCACAAAGGCTCCATTGGAACTTCTAGGCCAGCACACTATCATGTCTTGCTTGATGAGATTGTGGCTTTTCTGCCAATGAACTGCAAAACCTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

104

Amino Acids

11.91

Weight (kDa)

8.61

Isoelectric Point (pI)

38.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Piwi PF02171 23 - 94 9.3e-25 Piwi domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 64
AflIII ACRYGT 1 cut(s) 213
AjnI CCWGG 2 cut(s) 32, 160
AjuI GAANNNNNNNTTGG 2 cut(s) 123, 155
AluBI AGCT 3 cut(s) 39, 124, 134
AluI AGCT 3 cut(s) 39, 124, 134
Alw21I GWGCWC 1 cut(s) 223
AoxI GGCC 1 cut(s) 248
ApoI RAATTY 1 cut(s) 83
Bbv12I GWGCWC 1 cut(s) 223
BciT130I CCWGG 2 cut(s) 34, 162
BclI TGATCA 1 cut(s) 10
BfaI CTAG 1 cut(s) 246
Bme1390I CCNGG 2 cut(s) 34, 162
BmiI GGNNCC 1 cut(s) 232
BmrFI CCNGG 2 cut(s) 34, 162
BmsI GCATC 1 cut(s) 199
BpmI CTGGAG 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 194
BsaXI ACNNNNNCTCC 2 cut(s) 215, 245
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseBI CCWGG 2 cut(s) 34, 162
BseDI CCNNGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 190
BseLI CCNNNNNNNGG 1 cut(s) 64
BseYI CCCAGC 1 cut(s) 144
BshFI GGCC 1 cut(s) 250
BsiHKAI GWGCWC 1 cut(s) 223
BslI CCNNNNNNNGG 1 cut(s) 64
BsnI GGCC 1 cut(s) 250
Bsp1286I GDGCHC 1 cut(s) 223
Bsp143I GATC 1 cut(s) 10
BspANI GGCC 1 cut(s) 250
BspLI GGNNCC 1 cut(s) 232
BssECI CCNNGG 1 cut(s) 194
BssMI GATC 1 cut(s) 10
BssT1I CCWWGG 1 cut(s) 194
Bst2UI CCWGG 2 cut(s) 34, 162
Bst4CI ACNGT 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 252
BstF5I GGATG 1 cut(s) 190
BstKTI GATC 1 cut(s) 13
BstMBI GATC 1 cut(s) 10
BstNI CCWGG 2 cut(s) 34, 162
BstNSI RCATGY 1 cut(s) 217
BstSCI CCNGG 2 cut(s) 32, 160
BsuRI GGCC 1 cut(s) 250
BtsCI GGATG 1 cut(s) 190
Cac8I GCNNGC 1 cut(s) 252
CviAII CATG 3 cut(s) 14, 214, 263
CviJI RGCY 8 cut(s) 39, 47, 101, 124, 134, 231, 250, 287
CviKI_1 RGCY 8 cut(s) 39, 47, 101, 124, 134, 231, 250, 287
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
Eco130I CCWWGG 1 cut(s) 194
EcoRII CCWGG 2 cut(s) 32, 160
EcoT14I CCWWGG 1 cut(s) 194
ErhI CCWWGG 1 cut(s) 194
FaeI CATG 3 cut(s) 17, 217, 266
FaiI YATR 6 cut(s) 15, 114, 150, 204, 215, 264
FatI CATG 3 cut(s) 13, 213, 262
FbaI TGATCA 1 cut(s) 10
FokI GGATG 1 cut(s) 177
FspBI CTAG 1 cut(s) 246
GsaI CCCAGC 1 cut(s) 148
GsuI CTGGAG 1 cut(s) 55
HaeIII GGCC 1 cut(s) 250
Hin1II CATG 3 cut(s) 17, 217, 266
HinfI GANTC 1 cut(s) 76
Hpy166II GTNNAC 1 cut(s) 175
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4V TGCA 2 cut(s) 190, 306
Hsp92II CATG 3 cut(s) 17, 217, 266
Ksp22I TGATCA 1 cut(s) 10
Kzo9I GATC 1 cut(s) 10
LmnI GCTCC 2 cut(s) 36, 236
LpnPI CCDG 8 cut(s) 19, 29, 46, 74, 147, 158, 174, 264
LweI GCATC 1 cut(s) 199
MaeI CTAG 1 cut(s) 246
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MhlI GDGCHC 1 cut(s) 223
MluCI AATT 2 cut(s) 83, 199
MseI TTAA 2 cut(s) 6, 87
MslI CAYNNNNRTG 1 cut(s) 261
MspR9I CCNGG 2 cut(s) 34, 162
MvaI CCWGG 2 cut(s) 34, 162
NdeII GATC 1 cut(s) 10
NlaIII CATG 3 cut(s) 17, 217, 266
NlaIV GGNNCC 1 cut(s) 232
NspI RCATGY 1 cut(s) 217
PciI ACATGT 1 cut(s) 213
PfeI GAWTC 1 cut(s) 76
PfoI TCCNGGA 1 cut(s) 32
PscI ACATGT 1 cut(s) 213
Psp6I CCWGG 2 cut(s) 32, 160
PspFI CCCAGC 1 cut(s) 144
PspGI CCWGG 2 cut(s) 32, 160
PspN4I GGNNCC 1 cut(s) 232
RseI CAYNNNNRTG 1 cut(s) 261
SaqAI TTAA 2 cut(s) 6, 87
Sau3AI GATC 1 cut(s) 10
ScrFI CCNGG 2 cut(s) 34, 162
SduI GDGCHC 1 cut(s) 223
SetI ASST 5 cut(s) 41, 69, 126, 136, 314
SfaNI GCATC 1 cut(s) 199
SmiMI CAYNNNNRTG 1 cut(s) 261
Sse9I AATT 2 cut(s) 83, 199
SspI AATATT 1 cut(s) 184
SspMI CTAG 1 cut(s) 246
StyD4I CCNGG 2 cut(s) 32, 160
StyI CCWWGG 1 cut(s) 194
TaaI ACNGT 1 cut(s) 169
TasI AATT 2 cut(s) 83, 199
TfiI GAWTC 1 cut(s) 76
Tru1I TTAA 2 cut(s) 6, 87
Tru9I TTAA 2 cut(s) 6, 87
TspDTI ATGAA 1 cut(s) 314
XapI RAATTY 1 cut(s) 83
XceI RCATGY 1 cut(s) 217
XspI CTAG 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.