Rw2G049660

Transmembrane emp24 domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
OG0001491
Physical Location & Seq
Reverse (-)
77258069 .. 77259882
1814 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G049660.1

Sequence Viewer

Length: 561 bp
ATGTCGCCAATATTGATCTGTACATTTCTGATATTGTGCTTAATGTCAACGATGGCGGTTTCGATGCGGTTCGACCTTCAATCTGGCGCCACTAAATGCATCTCAGACGAAATAAAGAGCAATTCCATGACTGTGGGCAAGTACTCCACCGTCAATCCCAATGAGGGCTTTCCTCTTCCTGATACGCACAAAGTCACTGTCAGGGTAAACGGTGATTATTCAGTATGCTTTTGGGTAGTTGATCATAAGCCTCCGACCACGGTCACGATTGATTTTGACTGGAAAACTGGAGTTGAGGCCAAGGACTGGTCCAAGGTTGCCAAGAAAGGGCAGATTGAAATGATGGAACTTGAGCTGAAAAAGCTGTTTGATACTGTGACGTCCATTCATGATGAGATGTTTTATCTTCGTGAAAGGGAGGAAGAAATGCAACAACTTAATAGAGCAACTAACTCCAAGATGGCGACGTTTAGCTTCCTTTCTCTTGTAGTTTGCTTGTCTGTGGCCGGTTTGCAATTATGGCATCTCAAGATGTTCTTTGAGAGGAAGAAGCTCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EMP24_GP25L

Protein Analysis

186

Amino Acids

21.34

Weight (kDa)

6.89

Isoelectric Point (pI)

42.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EMP24_GP25L PF01105 62 - 181 5.5e-35 emp24/gp25L/p24 family/GOLD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 383
AccB1I GGYRCC 1 cut(s) 86
AccB7I CCANNNNNTGG 1 cut(s) 306
AciI CCGC 2 cut(s) 56, 67
AcoI YGGCCR 1 cut(s) 504
AcyI GRCGYC 2 cut(s) 87, 380
AfaI GTAC 2 cut(s) 22, 143
AfiI CCNNNNNNNGG 3 cut(s) 164, 306, 327
AgsI TTSAA 2 cut(s) 80, 338
AluBI AGCT 4 cut(s) 355, 364, 474, 553
AluI AGCT 4 cut(s) 355, 364, 474, 553
AoxI GGCC 2 cut(s) 297, 504
ArsI GACNNNNNNTTYG 2 cut(s) 183, 215
AspLEI GCGC 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 309
AsuHPI GGTGA 1 cut(s) 224
AvaII GGWCC 1 cut(s) 309
BanI GGYRCC 1 cut(s) 86
BccI CCATC 3 cut(s) 46, 337, 454
BclI TGATCA 1 cut(s) 241
BfaI CTAG 1 cut(s) 559
BfoI RGCGCY 1 cut(s) 90
BmcAI AGTACT 1 cut(s) 143
Bme18I GGWCC 1 cut(s) 309
BmgT120I GGNCC 1 cut(s) 309
BmiI GGNNCC 1 cut(s) 88
BmsI GCATC 3 cut(s) 54, 108, 532
BoxI GACNNNNGTC 1 cut(s) 260
BpmI CTGGAG 1 cut(s) 309
BpuEI CTTGAG 2 cut(s) 371, 512
BsaHI GRCGYC 2 cut(s) 87, 380
BsaJI CCNNGG 3 cut(s) 258, 300, 312
Bsc4I CCNNNNNNNGG 3 cut(s) 164, 306, 327
Bse118I RCCGGY 1 cut(s) 506
Bse1I ACTGG 3 cut(s) 284, 292, 311
BseDI CCNNGG 3 cut(s) 258, 300, 312
BseLI CCNNNNNNNGG 3 cut(s) 164, 306, 327
BseMII CTCAG 1 cut(s) 117
BseNI ACTGG 3 cut(s) 284, 292, 311
BseRI GAGGAG 1 cut(s) 545
BshFI GGCC 2 cut(s) 299, 506
BshNI GGYRCC 1 cut(s) 86
BsiSI CCGG 1 cut(s) 507
BslI CCNNNNNNNGG 3 cut(s) 164, 306, 327
BsnI GGCC 2 cut(s) 299, 506
Bsp1407I TGTACA 1 cut(s) 20
Bsp143I GATC 2 cut(s) 15, 241
BspACI CCGC 2 cut(s) 56, 67
BspANI GGCC 2 cut(s) 299, 506
BspCNI CTCAG 1 cut(s) 116
BspHI TCATGA 1 cut(s) 388
BspLI GGNNCC 1 cut(s) 88
BspT107I GGYRCC 1 cut(s) 86
BsrFI RCCGGY 1 cut(s) 506
BsrGI TGTACA 1 cut(s) 20
BsrI ACTGG 3 cut(s) 284, 292, 311
BssAI RCCGGY 1 cut(s) 506
BssECI CCNNGG 3 cut(s) 258, 300, 312
BssMI GATC 2 cut(s) 15, 241
BssNI GRCGYC 2 cut(s) 87, 380
BssT1I CCWWGG 2 cut(s) 300, 312
Bst4CI ACNGT 6 cut(s) 133, 151, 199, 212, 262, 376
Bst6I CTCTTC 1 cut(s) 180
BstACI GRCGYC 2 cut(s) 87, 380
BstAUI TGTACA 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 103
BstDSI CCRYGG 1 cut(s) 258
BstH2I RGCGCY 1 cut(s) 90
BstHHI GCGC 1 cut(s) 89
BstKTI GATC 2 cut(s) 18, 244
BstMBI GATC 2 cut(s) 15, 241
BstMWI GCNNNNNNNGC 2 cut(s) 361, 520
BstPAI GACNNNNGTC 1 cut(s) 260
BstXI CCANNNNNNTGG 1 cut(s) 133
BsuRI GGCC 2 cut(s) 299, 506
BtgI CCRYGG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 195
CciI TCATGA 1 cut(s) 388
CfoI GCGC 1 cut(s) 89
Cfr10I RCCGGY 1 cut(s) 506
Cfr13I GGNCC 1 cut(s) 309
Csp6I GTAC 2 cut(s) 21, 142
CviAII CATG 2 cut(s) 127, 389
CviJI RGCY 8 cut(s) 168, 250, 299, 355, 364, 474, 506, 553
CviKI_1 RGCY 8 cut(s) 168, 250, 299, 355, 364, 474, 506, 553
CviQI GTAC 2 cut(s) 21, 142
DdeI CTNAG 1 cut(s) 103
DinI GGCGCC 1 cut(s) 88
DpnI GATC 2 cut(s) 17, 243
DpnII GATC 2 cut(s) 15, 241
EaeI YGGCCR 1 cut(s) 504
Eam1104I CTCTTC 1 cut(s) 180
EarI CTCTTC 1 cut(s) 180
Eco130I CCWWGG 2 cut(s) 300, 312
Eco47I GGWCC 1 cut(s) 309
EcoT14I CCWWGG 2 cut(s) 300, 312
EcoT22I ATGCAT 1 cut(s) 101
EgeI GGCGCC 1 cut(s) 88
EheI GGCGCC 1 cut(s) 88
ErhI CCWWGG 2 cut(s) 300, 312
FaeI CATG 2 cut(s) 130, 392
FaiI YATR 5 cut(s) 128, 226, 246, 390, 520
FalI AAGNNNNNCTT 2 cut(s) 521, 553
FatI CATG 2 cut(s) 126, 388
FbaI TGATCA 1 cut(s) 241
FspBI CTAG 1 cut(s) 559
GlaI GCGC 1 cut(s) 88
GsuI CTGGAG 1 cut(s) 309
HaeII RGCGCY 1 cut(s) 90
HaeIII GGCC 2 cut(s) 299, 506
HapII CCGG 1 cut(s) 507
HhaI GCGC 1 cut(s) 89
Hin1I GRCGYC 2 cut(s) 87, 380
Hin1II CATG 2 cut(s) 130, 392
Hin6I GCGC 1 cut(s) 87
HinP1I GCGC 1 cut(s) 87
HincII GTYRAC 1 cut(s) 48
HindII GTYRAC 1 cut(s) 48
HpaII CCGG 1 cut(s) 507
HphI GGTGA 1 cut(s) 224
Hpy166II GTNNAC 2 cut(s) 48, 208
Hpy188I TCNGA 3 cut(s) 30, 106, 255
Hpy188III TCNNGA 5 cut(s) 179, 265, 389, 410, 529
Hpy8I GTNNAC 2 cut(s) 48, 208
Hpy99I CGWCG 1 cut(s) 469
HpyAV CCTTC 1 cut(s) 86
HpyCH4III ACNGT 6 cut(s) 133, 151, 199, 212, 262, 376
HpyCH4IV ACGT 2 cut(s) 380, 467
HpyCH4V TGCA 3 cut(s) 99, 430, 514
HpyF10VI GCNNNNNNNGC 2 cut(s) 361, 520
HpyF3I CTNAG 1 cut(s) 103
HpySE526I ACGT 2 cut(s) 380, 467
Hsp92I GRCGYC 2 cut(s) 87, 380
Hsp92II CATG 2 cut(s) 130, 392
HspAI GCGC 1 cut(s) 87
KasI GGCGCC 1 cut(s) 86
Ksp22I TGATCA 1 cut(s) 241
Kzo9I GATC 2 cut(s) 15, 241
LmnI GCTCC 1 cut(s) 558
LpnPI CCDG 7 cut(s) 69, 187, 192, 265, 273, 292, 520
LweI GCATC 3 cut(s) 54, 108, 532
MaeI CTAG 1 cut(s) 559
MaeII ACGT 2 cut(s) 380, 467
MaeIII GTNAC 3 cut(s) 193, 262, 376
MalI GATC 2 cut(s) 17, 243
MboI GATC 2 cut(s) 15, 241
MboII GAAGA 4 cut(s) 167, 398, 434, 559
MluCI AATT 2 cut(s) 121, 515
Mly113I GGCGCC 1 cut(s) 87
MmeI TCCRAC 1 cut(s) 278
MnlI CCTC 6 cut(s) 157, 183, 261, 289, 412, 537
Mph1103I ATGCAT 1 cut(s) 101
MseI TTAA 2 cut(s) 41, 438
MslI CAYNNNNRTG 1 cut(s) 131
MspI CCGG 1 cut(s) 507
MwoI GCNNNNNNNGC 2 cut(s) 361, 520
NarI GGCGCC 1 cut(s) 87
NdeII GATC 2 cut(s) 15, 241
NlaIII CATG 2 cut(s) 130, 392
NlaIV GGNNCC 1 cut(s) 88
NmuCI GTSAC 3 cut(s) 193, 262, 376
NsiI ATGCAT 1 cut(s) 101
PagI TCATGA 1 cut(s) 388
PflMI CCANNNNNTGG 1 cut(s) 306
PluTI GGCGCC 1 cut(s) 90
PshAI GACNNNNGTC 1 cut(s) 260
PspN4I GGNNCC 1 cut(s) 88
PspPI GGNCC 1 cut(s) 309
RsaI GTAC 2 cut(s) 22, 143
RsaNI GTAC 2 cut(s) 21, 142
RseI CAYNNNNRTG 1 cut(s) 131
SaqAI TTAA 2 cut(s) 41, 438
Sau3AI GATC 2 cut(s) 15, 241
Sau96I GGNCC 1 cut(s) 309
ScaI AGTACT 1 cut(s) 143
SetI ASST 8 cut(s) 78, 318, 357, 366, 383, 470, 476, 555
SfaNI GCATC 3 cut(s) 54, 108, 532
SfoI GGCGCC 1 cut(s) 88
SinI GGWCC 1 cut(s) 309
SmiMI CAYNNNNRTG 1 cut(s) 131
SmlI CTYRAG 2 cut(s) 350, 527
SmoI CTYRAG 2 cut(s) 350, 527
Sse9I AATT 2 cut(s) 121, 515
SsiI CCGC 2 cut(s) 56, 67
SspDI GGCGCC 1 cut(s) 86
SspI AATATT 1 cut(s) 12
SspMI CTAG 1 cut(s) 559
StyI CCWWGG 2 cut(s) 300, 312
TaaI ACNGT 6 cut(s) 133, 151, 199, 212, 262, 376
TaiI ACGT 2 cut(s) 383, 470
TaqI TCGA 2 cut(s) 62, 72
TasI AATT 2 cut(s) 121, 515
TatI WGTACW 2 cut(s) 20, 141
Tru1I TTAA 2 cut(s) 41, 438
Tru9I TTAA 2 cut(s) 41, 438
TscAI CASTG 1 cut(s) 202
TseFI GTSAC 3 cut(s) 193, 262, 376
Tsp45I GTSAC 3 cut(s) 193, 262, 376
TspDTI ATGAA 1 cut(s) 377
TspRI CASTG 1 cut(s) 202
Van91I CCANNNNNTGG 1 cut(s) 306
VpaK11BI GGWCC 1 cut(s) 309
XspI CTAG 1 cut(s) 559
ZraI GACGTC 1 cut(s) 381
ZrmI AGTACT 1 cut(s) 143
Zsp2I ATGCAT 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.