FvH4_3g33922

Protein of unknown function (DUF 659)

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
29358261 .. 29358866
606 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g33922.t1

Sequence Viewer

Length: 519 bp
ATGGATAACCGAGATAGAGGATCCGGTTCTTCCACCGATCCACATTGGATTGAGGACAATGTGGAAGAATTGACATTGGATGATGGAGCGATCCGAAATGTGCCAAGTGGTACATATGAAAGTAGCCTAATTAGTCGTGATCCTCCTCCCCGTGTGCCTTCTCCTCCTCCCCATGTGCCTTCTTCTCCTCATGTGCCTACTCCTTCTCGTGAGCCTATTCCTTCCCGTGAGCCTACACCTTCTCTTGATGAGCCTATCCTTTTCTATAAAAGGAAATTTATGGAAGGACAAAGTTCAAGTAAGAGAAAAGCACCAAGAAAATCAATGCTTCTTGATGACATTGTAGATGATGATACTAGAAGTAATCGGTTTGATGATACTAATCCTCTCTTCCAATACGGTGATGATGATGATGAAGGTGGTGATGATGATGATGGTGATGATGGGGGTGATAGTGATGGTGATGATAGTTTGGATGGAGATATCTTAATTGATGATGATGATGACTTTGAAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

18.99

Weight (kDa)

4.05

Isoelectric Point (pI)

59.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 15, 28, 32, 85, 134
AcsI RAATTY 1 cut(s) 275
AfaI GTAC 1 cut(s) 112
AgsI TTSAA 2 cut(s) 297, 512
AlwI GGATC 5 cut(s) 15, 28, 32, 85, 134
ApoI RAATTY 1 cut(s) 275
AsuHPI GGTGA 5 cut(s) 413, 434, 449, 461, 473
BamHI GGATCC 1 cut(s) 20
BauI CACGAG 1 cut(s) 207
BccI CCATC 5 cut(s) 77, 428, 437, 452, 470
BfaI CTAG 1 cut(s) 357
BmiI GGNNCC 1 cut(s) 22
BsaBI GATNNNNATC 1 cut(s) 381
BsaWI WCCGGW 1 cut(s) 23
Bse8I GATNNNNATC 1 cut(s) 381
BseGI GGATG 2 cut(s) 85, 481
BseJI GATNNNNATC 1 cut(s) 381
BseRI GAGGAG 4 cut(s) 135, 153, 156, 177
BsiSI CCGG 1 cut(s) 24
Bsp143I GATC 4 cut(s) 20, 37, 90, 139
BspLI GGNNCC 1 cut(s) 22
BspPI GGATC 5 cut(s) 15, 28, 32, 85, 134
BssMI GATC 4 cut(s) 20, 37, 90, 139
BssSI CACGAG 1 cut(s) 207
Bst2BI CACGAG 1 cut(s) 207
Bst4CI ACNGT 1 cut(s) 401
Bst6I CTCTTC 1 cut(s) 395
BstF5I GGATG 2 cut(s) 85, 481
BstKTI GATC 4 cut(s) 23, 40, 93, 142
BstMBI GATC 4 cut(s) 20, 37, 90, 139
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
BtsCI GGATG 2 cut(s) 85, 481
Csp6I GTAC 1 cut(s) 111
CviAII CATG 3 cut(s) 173, 191, 516
CviJI RGCY 4 cut(s) 126, 214, 232, 253
CviKI_1 RGCY 4 cut(s) 126, 214, 232, 253
CviQI GTAC 1 cut(s) 111
DpnI GATC 4 cut(s) 22, 39, 92, 141
DpnII GATC 4 cut(s) 20, 37, 90, 139
Eam1104I CTCTTC 1 cut(s) 395
EarI CTCTTC 1 cut(s) 395
Eco32I GATATC 1 cut(s) 484
EcoRV GATATC 1 cut(s) 484
FaeI CATG 3 cut(s) 176, 194, 519
FaiI YATR 7 cut(s) 115, 117, 174, 192, 267, 281, 517
FatI CATG 3 cut(s) 172, 190, 515
FauNDI CATATG 1 cut(s) 115
FokI GGATG 2 cut(s) 92, 488
FspBI CTAG 1 cut(s) 357
HapII CCGG 1 cut(s) 24
Hin1II CATG 3 cut(s) 176, 194, 519
HpaII CCGG 1 cut(s) 24
HphI GGTGA 5 cut(s) 413, 434, 449, 461, 473
Hpy188I TCNGA 1 cut(s) 95
Hpy188III TCNNGA 4 cut(s) 137, 209, 245, 332
HpyAV CCTTC 7 cut(s) 168, 189, 213, 231, 249, 278, 410
HpyCH4III ACNGT 1 cut(s) 401
Hsp92II CATG 3 cut(s) 176, 194, 519
Kzo9I GATC 4 cut(s) 20, 37, 90, 139
LmnI GCTCC 1 cut(s) 86
LpnPI CCDG 1 cut(s) 37
MaeI CTAG 1 cut(s) 357
MalI GATC 4 cut(s) 22, 39, 92, 141
MboI GATC 4 cut(s) 20, 37, 90, 139
MboII GAAGA 4 cut(s) 21, 77, 174, 382
MflI RGATCY 1 cut(s) 20
MluCI AATT 4 cut(s) 68, 129, 275, 489
MnlI CCTC 8 cut(s) 11, 46, 153, 156, 174, 177, 198, 396
MseI TTAA 1 cut(s) 488
MspI CCGG 1 cut(s) 24
NdeI CATATG 1 cut(s) 115
NdeII GATC 4 cut(s) 20, 37, 90, 139
NlaIII CATG 3 cut(s) 176, 194, 519
NlaIV GGNNCC 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 22
PsuI RGATCY 1 cut(s) 20
RsaI GTAC 1 cut(s) 112
RsaNI GTAC 1 cut(s) 111
SaqAI TTAA 1 cut(s) 488
Sau3AI GATC 4 cut(s) 20, 37, 90, 139
SetI ASST 2 cut(s) 241, 421
Sse9I AATT 4 cut(s) 68, 129, 275, 489
SspMI CTAG 1 cut(s) 357
TaaI ACNGT 1 cut(s) 401
TasI AATT 4 cut(s) 68, 129, 275, 489
Tru1I TTAA 1 cut(s) 488
Tru9I TTAA 1 cut(s) 488
TspDTI ATGAA 2 cut(s) 132, 429
XapI RAATTY 1 cut(s) 275
XspI CTAG 1 cut(s) 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.